Incidental Mutation 'R1115:Coro2b'
ID97178
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 039188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1115 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62431327 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 208 (E208A)
Ref Sequence ENSEMBL: ENSMUSP00000041826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171] [ENSMUST00000174439]
Predicted Effect probably damaging
Transcript: ENSMUST00000048043
AA Change: E208A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: E208A

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131981
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect possibly damaging
Transcript: ENSMUST00000164246
AA Change: E203A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729
AA Change: E203A

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174439
AA Change: E83A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729
AA Change: E83A

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Meta Mutation Damage Score 0.5145 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C A 11: 100,479,255 V994F probably damaging Het
Arfgap3 T C 15: 83,330,540 T182A probably benign Het
Bcl2l14 T C 6: 134,432,139 probably benign Het
Cabin1 T C 10: 75,717,677 M1183V possibly damaging Het
Ccr7 A T 11: 99,145,277 I273K possibly damaging Het
Cd40 A G 2: 165,070,761 M211V possibly damaging Het
Dennd5a A C 7: 109,918,761 M556R probably damaging Het
Efcab2 A T 1: 178,437,497 probably benign Het
Fam160a1 T C 3: 85,722,495 E263G probably benign Het
Fastkd2 T C 1: 63,747,955 probably benign Het
Fbxw8 A C 5: 118,077,571 probably benign Het
Frem1 T C 4: 83,020,770 D25G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ift52 A G 2: 163,029,782 K178R probably benign Het
Kit T C 5: 75,649,532 probably benign Het
Map1a T C 2: 121,307,378 probably null Het
Mxra7 G T 11: 116,810,870 probably benign Het
Myt1 C A 2: 181,811,231 S7* probably null Het
Nphs1 C T 7: 30,481,378 probably benign Het
Olfr355 C A 2: 36,927,502 G204V possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Osgin2 A T 4: 15,998,085 D512E possibly damaging Het
Pde4b T A 4: 102,542,155 probably benign Het
Rasef G T 4: 73,748,604 T146K possibly damaging Het
Ren1 T A 1: 133,356,518 V207D probably damaging Het
S100a8 A G 3: 90,669,873 D59G probably damaging Het
Sdcbp G A 4: 6,377,143 probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Slamf7 A T 1: 171,639,183 D151E probably benign Het
Slco1b2 A G 6: 141,683,254 M561V probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stard9 T C 2: 120,692,850 I662T probably benign Het
Vwf T A 6: 125,655,065 V20D unknown Het
Znhit6 G T 3: 145,594,685 probably null Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
PIT4151001:Coro2b UTSW 9 62429004 missense probably damaging 1.00
R0422:Coro2b UTSW 9 62427977 missense probably benign 0.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62427981 missense probably benign 0.08
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1422:Coro2b UTSW 9 62428947 critical splice donor site probably null
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 splice site probably null
R3971:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R5702:Coro2b UTSW 9 62426577 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense possibly damaging 0.81
R7347:Coro2b UTSW 9 62489372 missense probably benign
R8199:Coro2b UTSW 9 62429020 missense probably benign 0.00
R8447:Coro2b UTSW 9 62426560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCAGGCAGAAGAATCAGTCC -3'
(R):5'- CCACAGCAGCCAGTGACTTTATCC -3'

Sequencing Primer
(F):5'- GGCAGAAGAATCAGTCCCCTTTAG -3'
(R):5'- AGCCAGTGACTTTATCCACTGC -3'
Posted On2014-01-05