Incidental Mutation 'R1115:Ccr7'
ID97192
Institutional Source Beutler Lab
Gene Symbol Ccr7
Ensembl Gene ENSMUSG00000037944
Gene Namechemokine (C-C motif) receptor 7
SynonymsEBI1, Ebi1h, Cmkbr7, CD197
MMRRC Submission 039188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R1115 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99144196-99155077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99145277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 273 (I273K)
Ref Sequence ENSEMBL: ENSMUSP00000099423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103134
AA Change: I273K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099423
Gene: ENSMUSG00000037944
AA Change: I273K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 75 326 1.8e-49 PFAM
Meta Mutation Damage Score 0.6427 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice exhibit an impaired primary immune response. Dendritic cells, B, T and T regulatory cells show impaired migration to the lymph nodes and secondary lymph organs exhibit morphological abnormalities. Lymphocytic infiltrates to the pancreas, lung and stomach are observed in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C A 11: 100,479,255 V994F probably damaging Het
Arfgap3 T C 15: 83,330,540 T182A probably benign Het
Bcl2l14 T C 6: 134,432,139 probably benign Het
Cabin1 T C 10: 75,717,677 M1183V possibly damaging Het
Cd40 A G 2: 165,070,761 M211V possibly damaging Het
Coro2b T G 9: 62,431,327 E208A probably damaging Het
Dennd5a A C 7: 109,918,761 M556R probably damaging Het
Efcab2 A T 1: 178,437,497 probably benign Het
Fam160a1 T C 3: 85,722,495 E263G probably benign Het
Fastkd2 T C 1: 63,747,955 probably benign Het
Fbxw8 A C 5: 118,077,571 probably benign Het
Frem1 T C 4: 83,020,770 D25G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ift52 A G 2: 163,029,782 K178R probably benign Het
Kit T C 5: 75,649,532 probably benign Het
Map1a T C 2: 121,307,378 probably null Het
Mxra7 G T 11: 116,810,870 probably benign Het
Myt1 C A 2: 181,811,231 S7* probably null Het
Nphs1 C T 7: 30,481,378 probably benign Het
Olfr355 C A 2: 36,927,502 G204V possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Osgin2 A T 4: 15,998,085 D512E possibly damaging Het
Pde4b T A 4: 102,542,155 probably benign Het
Rasef G T 4: 73,748,604 T146K possibly damaging Het
Ren1 T A 1: 133,356,518 V207D probably damaging Het
S100a8 A G 3: 90,669,873 D59G probably damaging Het
Sdcbp G A 4: 6,377,143 probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Slamf7 A T 1: 171,639,183 D151E probably benign Het
Slco1b2 A G 6: 141,683,254 M561V probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stard9 T C 2: 120,692,850 I662T probably benign Het
Vwf T A 6: 125,655,065 V20D unknown Het
Znhit6 G T 3: 145,594,685 probably null Het
Other mutations in Ccr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Ccr7 APN 11 99145145 missense probably benign 0.45
lanzhou UTSW 11 99145277 missense possibly damaging 0.90
IGL03047:Ccr7 UTSW 11 99145334 missense probably benign 0.44
R0707:Ccr7 UTSW 11 99145983 missense probably damaging 1.00
R1664:Ccr7 UTSW 11 99145691 missense possibly damaging 0.90
R2291:Ccr7 UTSW 11 99145335 missense probably damaging 1.00
R3743:Ccr7 UTSW 11 99145207 missense possibly damaging 0.86
R4108:Ccr7 UTSW 11 99145378 missense probably damaging 1.00
R4214:Ccr7 UTSW 11 99145046 missense probably damaging 0.98
R5402:Ccr7 UTSW 11 99145734 missense possibly damaging 0.93
R5602:Ccr7 UTSW 11 99145489 missense probably benign 0.08
R6275:Ccr7 UTSW 11 99145663 missense probably damaging 1.00
R6991:Ccr7 UTSW 11 99145304 missense probably damaging 1.00
R7470:Ccr7 UTSW 11 99145557 missense possibly damaging 0.80
R7549:Ccr7 UTSW 11 99145901 missense probably damaging 1.00
Z1176:Ccr7 UTSW 11 99144980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGACGCCGATGAAGGCATAC -3'
(R):5'- CCTATGCATCAGCATTGACCGCTAC -3'

Sequencing Primer
(F):5'- CATACAAGAAAGGGTTGACGC -3'
(R):5'- ATCAGCAAGCTGTCCTGTG -3'
Posted On2014-01-05