Mutagenetix > Incidental Mutation

Incidental Mutation 'R0981:Asap2'

97193

Institutional Source

Beutler Lab

Gene Symbol

Asap2

Ensembl Gene

ENSMUSG00000052632

Gene Name

ArfGAP with SH3 domain, ankyrin repeat and PH domain 2

Synonyms

6530401G17Rik, LOC385250, Ddef2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R0981 (G1)

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

20990459-21270171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21265960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 960 (S960P)

Ref Sequence

ENSEMBL: ENSMUSP00000063217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000076260] [ENSMUST00000090834] [ENSMUST00000101562] [ENSMUST00000173729] [ENSMUST00000232072]

AlphaFold

Q7SIG6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050990
AA Change: S915P

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: S915P

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
SH3	896	954	4.28e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000064595
AA Change: S960P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: S960P

Domain	Start	End	E-Value	Type
Pfam:BAR	11	247	2.4e-9	PFAM
Pfam:BAR_3	31	265	3.3e-28	PFAM
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	837	849	N/A	INTRINSIC
low complexity region	872	892	N/A	INTRINSIC
SH3	941	999	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000076260

SMART Domains

Protein: ENSMUSP00000075609
Gene: ENSMUSG00000062352

Domain	Start	End	E-Value	Type
low complexity region	4	29	N/A	INTRINSIC
PTB	58	200	1.42e-22	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000090834
AA Change: S769P

SMART Domains

Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: S769P

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
Blast:PH	196	318	1e-50	BLAST
Blast:ArfGap	334	395	5e-30	BLAST
ANK	438	470	6.17e-1	SMART
ANK	474	503	4.03e-5	SMART
ANK	507	537	1.48e3	SMART
low complexity region	547	561	N/A	INTRINSIC
low complexity region	619	643	N/A	INTRINSIC
low complexity region	681	701	N/A	INTRINSIC
SH3	750	808	4.28e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101562
AA Change: S918P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: S918P

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	309	402	2.31e-18	SMART
ArfGap	424	544	6.82e-27	SMART
ANK	587	619	6.17e-1	SMART
ANK	623	652	4.03e-5	SMART
ANK	656	686	1.48e3	SMART
low complexity region	696	710	N/A	INTRINSIC
low complexity region	768	792	N/A	INTRINSIC
low complexity region	830	850	N/A	INTRINSIC
SH3	899	957	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173688

SMART Domains

Protein: ENSMUSP00000133557
Gene: ENSMUSG00000062352

Domain	Start	End	E-Value	Type
Pfam:ICAP-1_inte_bdg	1	79	1.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173729

SMART Domains

Protein: ENSMUSP00000134627
Gene: ENSMUSG00000062352

Domain	Start	End	E-Value	Type
low complexity region	4	29	N/A	INTRINSIC
PTB	58	200	1.42e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000232072

Coding Region Coverage

1x: 99.5%
3x: 98.4%
10x: 95.4%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,520,331	C942S	probably damaging	Het
Alpk1	T	C	3: 127,679,402	N984S	possibly damaging	Het
Ankrd55	T	C	13: 112,323,076	V68A	possibly damaging	Het
Atp2b1	T	A	10: 99,015,629	N66K	probably damaging	Het
Cckar	C	T	5: 53,706,290	G39R	probably damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Cpb1	C	A	3: 20,275,490	R24L	probably benign	Het
Dlg5	T	G	14: 24,154,631	R1258S	probably damaging	Het
Fam71e2	T	A	7: 4,757,589		probably null	Het
Fanci	A	G	7: 79,405,166	Q148R	probably benign	Het
Fcgbp	T	A	7: 28,085,110	Y198*	probably null	Het
Gapt	G	C	13: 110,353,739	T130R	probably damaging	Het
Glis1	A	G	4: 107,615,042	E272G	probably damaging	Het
Gm13741	T	C	2: 87,656,234	N229S	probably benign	Het
Gsdmc4	T	A	15: 63,892,073	I392F	probably damaging	Het
H2-M2	T	C	17: 37,482,630	T162A	probably benign	Het
Hk2	G	A	6: 82,743,968	R190W	probably damaging	Het
Irf1	T	C	11: 53,773,722	*52R	probably null	Het
Lman2l	T	A	1: 36,445,233	M1L	unknown	Het
Mgat1	C	T	11: 49,261,055	R122C	probably damaging	Het
Mtrf1	T	C	14: 79,401,590	L54S	probably benign	Het
Myo5c	A	T	9: 75,271,591	L676F	probably damaging	Het
Odf3	A	G	7: 140,848,295	M7V	probably benign	Het
Ofcc1	A	G	13: 40,072,698	I786T	probably damaging	Het
Olfr488	AGGT	A	7: 108,256,021		probably benign	Het
Olfr488	GGTAG	GG	7: 108,256,022		probably benign	Het
Pfn1	G	A	11: 70,652,138	R137C	probably benign	Het
Pgbd5	G	A	8: 124,384,293	R129*	probably null	Het
Pibf1	T	C	14: 99,150,743		probably null	Het
Pkd2l1	A	G	19: 44,154,422		probably null	Het
Plin5	C	A	17: 56,114,020	R215L	probably damaging	Het
Prrc2c	C	T	1: 162,705,981		probably benign	Het
Rnasel	T	G	1: 153,759,599	C608G	probably benign	Het
Slc28a2	T	A	2: 122,450,984	V218D	probably damaging	Het
Snx1	T	C	9: 66,109,559	I29V	probably benign	Het
Tenm3	A	G	8: 48,298,965	W939R	probably damaging	Het
Tmem237	C	A	1: 59,118,005	R15L	probably damaging	Het
Tmx3	T	C	18: 90,537,200	V347A	probably benign	Het
Vmn1r191	T	C	13: 22,179,219	T122A	probably benign	Het
Wdfy4	G	T	14: 33,147,092	N326K	probably benign	Het
Zfp408	A	G	2: 91,645,183	L642P	probably benign	Het
Zfp808	C	A	13: 62,171,673	H239N	possibly damaging	Het

Other mutations in Asap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Asap2	APN	12	21239648	missense	possibly damaging	0.66
IGL01140:Asap2	APN	12	21206316	missense	probably damaging	1.00
IGL01285:Asap2	APN	12	21229263	missense	probably damaging	1.00
IGL01318:Asap2	APN	12	21247295	missense	probably null	0.00
IGL01355:Asap2	APN	12	21218086	splice site	probably benign
IGL01593:Asap2	APN	12	21213202	missense	probably null	0.03
IGL01705:Asap2	APN	12	21249368	missense	possibly damaging	0.85
IGL01716:Asap2	APN	12	21254306	missense	possibly damaging	0.94
IGL02822:Asap2	APN	12	21265910	missense	probably damaging	1.00
IGL02876:Asap2	APN	12	21258163	missense	probably benign	0.00
IGL02991:Asap2	APN	12	21249293	splice site	probably benign
R0157:Asap2	UTSW	12	21206325	missense	probably damaging	1.00
R0399:Asap2	UTSW	12	21217997	missense	possibly damaging	0.90
R0472:Asap2	UTSW	12	21213185	missense	possibly damaging	0.47
R0959:Asap2	UTSW	12	21247319	missense	probably damaging	1.00
R1141:Asap2	UTSW	12	21185110	missense	probably damaging	1.00
R1382:Asap2	UTSW	12	21265954	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239585	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239589	missense	probably damaging	1.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1526:Asap2	UTSW	12	21185187	missense	probably damaging	1.00
R1542:Asap2	UTSW	12	21265997	missense	probably damaging	1.00
R1710:Asap2	UTSW	12	21224392	missense	probably damaging	1.00
R1750:Asap2	UTSW	12	21203998	missense	probably damaging	1.00
R2151:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2152:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2154:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2323:Asap2	UTSW	12	21203968	missense	probably damaging	1.00
R2378:Asap2	UTSW	12	21254318	missense	possibly damaging	0.95
R3151:Asap2	UTSW	12	21224377	missense	probably damaging	1.00
R3757:Asap2	UTSW	12	21267766	missense	probably damaging	1.00
R4305:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4307:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4308:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4345:Asap2	UTSW	12	21230831	missense	probably damaging	1.00
R4525:Asap2	UTSW	12	21229292	splice site	probably null
R4562:Asap2	UTSW	12	21112093	missense	probably damaging	1.00
R4999:Asap2	UTSW	12	21252765	missense	probably benign	0.19
R5027:Asap2	UTSW	12	21204081	missense	probably damaging	1.00
R5221:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R5645:Asap2	UTSW	12	21265982	missense	probably damaging	0.99
R5799:Asap2	UTSW	12	21168246	missense	probably damaging	1.00
R5876:Asap2	UTSW	12	21212809	missense	possibly damaging	0.88
R5888:Asap2	UTSW	12	21218190	missense	probably damaging	1.00
R5912:Asap2	UTSW	12	21206343	missense	probably damaging	1.00
R6576:Asap2	UTSW	12	21244703	missense	probably damaging	1.00
R6896:Asap2	UTSW	12	21265525	missense	probably damaging	1.00
R6934:Asap2	UTSW	12	21168250	missense	probably damaging	1.00
R7134:Asap2	UTSW	12	21265963	nonsense	probably null
R7347:Asap2	UTSW	12	21229457	missense	probably benign	0.03
R7378:Asap2	UTSW	12	21112051	missense	probably benign	0.01
R7515:Asap2	UTSW	12	21229239	missense	possibly damaging	0.76
R8033:Asap2	UTSW	12	21224389	missense	probably damaging	1.00
R8793:Asap2	UTSW	12	21168211	missense	probably damaging	1.00
R8891:Asap2	UTSW	12	21112143	missense	probably damaging	1.00
R8972:Asap2	UTSW	12	21229248	missense	probably damaging	1.00
R9021:Asap2	UTSW	12	21203998	missense	possibly damaging	0.94
R9216:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R9323:Asap2	UTSW	12	21112147	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCAGACCCCAGGTGTTTCATTTC -3'
(R):5'- GCAGCACCAGATCCAGATTGCTTAG -3'

Sequencing Primer
(F):5'- CCTCTGTGGGTTTCCGAGC -3'
(R):5'- AGAGCTTCCACTGTTCACAGG -3'

Posted On

2014-01-05