Incidental Mutation 'R0981:Asap2'
ID 97193
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene Name ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms 6530401G17Rik, LOC385250, Ddef2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R0981 (G1)
Quality Score 105
Status Not validated
Chromosome 12
Chromosomal Location 21161369-21320172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21315961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 960 (S960P)
Ref Sequence ENSEMBL: ENSMUSP00000063217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000076260] [ENSMUST00000090834] [ENSMUST00000101562] [ENSMUST00000232072] [ENSMUST00000173729]
AlphaFold Q7SIG6
Predicted Effect possibly damaging
Transcript: ENSMUST00000050990
AA Change: S915P

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: S915P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: S960P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: S960P

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076260
SMART Domains Protein: ENSMUSP00000075609
Gene: ENSMUSG00000062352

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000090834
AA Change: S769P
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: S769P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101562
AA Change: S918P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: S918P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173688
SMART Domains Protein: ENSMUSP00000133557
Gene: ENSMUSG00000062352

DomainStartEndE-ValueType
Pfam:ICAP-1_inte_bdg 1 79 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232072
Predicted Effect probably benign
Transcript: ENSMUST00000173729
SMART Domains Protein: ENSMUSP00000134627
Gene: ENSMUSG00000062352

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,831,257 (GRCm39) C942S probably damaging Het
Alpk1 T C 3: 127,473,051 (GRCm39) N984S possibly damaging Het
Ankrd55 T C 13: 112,459,610 (GRCm39) V68A possibly damaging Het
Atp2b1 T A 10: 98,851,491 (GRCm39) N66K probably damaging Het
Cckar C T 5: 53,863,632 (GRCm39) G39R probably damaging Het
Cimap1a A G 7: 140,428,208 (GRCm39) M7V probably benign Het
Col11a1 G A 3: 113,932,414 (GRCm39) R113H unknown Het
Cpb1 C A 3: 20,329,654 (GRCm39) R24L probably benign Het
Dlg5 T G 14: 24,204,699 (GRCm39) R1258S probably damaging Het
Fanci A G 7: 79,054,914 (GRCm39) Q148R probably benign Het
Fcgbp T A 7: 27,784,535 (GRCm39) Y198* probably null Het
Gapt G C 13: 110,490,273 (GRCm39) T130R probably damaging Het
Garin5b T A 7: 4,760,588 (GRCm39) probably null Het
Glis1 A G 4: 107,472,239 (GRCm39) E272G probably damaging Het
Gm13741 T C 2: 87,486,578 (GRCm39) N229S probably benign Het
Gsdmc4 T A 15: 63,763,922 (GRCm39) I392F probably damaging Het
H2-M2 T C 17: 37,793,521 (GRCm39) T162A probably benign Het
Hk2 G A 6: 82,720,949 (GRCm39) R190W probably damaging Het
Irf1 T C 11: 53,664,548 (GRCm39) *52R probably null Het
Lman2l T A 1: 36,484,314 (GRCm39) M1L unknown Het
Mgat1 C T 11: 49,151,882 (GRCm39) R122C probably damaging Het
Mtrf1 T C 14: 79,639,030 (GRCm39) L54S probably benign Het
Myo5c A T 9: 75,178,873 (GRCm39) L676F probably damaging Het
Ofcc1 A G 13: 40,226,174 (GRCm39) I786T probably damaging Het
Or5p64 AGGT A 7: 107,855,228 (GRCm39) probably benign Het
Or5p64 GGTAG GG 7: 107,855,229 (GRCm39) probably benign Het
Pfn1 G A 11: 70,542,964 (GRCm39) R137C probably benign Het
Pgbd5 G A 8: 125,111,032 (GRCm39) R129* probably null Het
Pibf1 T C 14: 99,388,179 (GRCm39) probably null Het
Pkd2l1 A G 19: 44,142,861 (GRCm39) probably null Het
Plin5 C A 17: 56,421,020 (GRCm39) R215L probably damaging Het
Prrc2c C T 1: 162,533,550 (GRCm39) probably benign Het
Rnasel T G 1: 153,635,345 (GRCm39) C608G probably benign Het
Slc28a2 T A 2: 122,281,465 (GRCm39) V218D probably damaging Het
Snx1 T C 9: 66,016,841 (GRCm39) I29V probably benign Het
Tenm3 A G 8: 48,752,000 (GRCm39) W939R probably damaging Het
Tmem237 C A 1: 59,157,164 (GRCm39) R15L probably damaging Het
Tmx3 T C 18: 90,555,324 (GRCm39) V347A probably benign Het
Vmn1r191 T C 13: 22,363,389 (GRCm39) T122A probably benign Het
Wdfy4 G T 14: 32,869,049 (GRCm39) N326K probably benign Het
Zfp408 A G 2: 91,475,528 (GRCm39) L642P probably benign Het
Zfp808 C A 13: 62,319,487 (GRCm39) H239N possibly damaging Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21,289,649 (GRCm39) missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21,256,317 (GRCm39) missense probably damaging 1.00
IGL01285:Asap2 APN 12 21,279,264 (GRCm39) missense probably damaging 1.00
IGL01318:Asap2 APN 12 21,297,296 (GRCm39) missense probably null 0.00
IGL01355:Asap2 APN 12 21,268,087 (GRCm39) splice site probably benign
IGL01593:Asap2 APN 12 21,263,203 (GRCm39) missense probably null 0.03
IGL01705:Asap2 APN 12 21,299,369 (GRCm39) missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21,304,307 (GRCm39) missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21,315,911 (GRCm39) missense probably damaging 1.00
IGL02876:Asap2 APN 12 21,308,164 (GRCm39) missense probably benign 0.00
IGL02991:Asap2 APN 12 21,299,294 (GRCm39) splice site probably benign
R0157:Asap2 UTSW 12 21,256,326 (GRCm39) missense probably damaging 1.00
R0399:Asap2 UTSW 12 21,267,998 (GRCm39) missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21,263,186 (GRCm39) missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21,297,320 (GRCm39) missense probably damaging 1.00
R1141:Asap2 UTSW 12 21,235,111 (GRCm39) missense probably damaging 1.00
R1382:Asap2 UTSW 12 21,315,955 (GRCm39) missense probably damaging 1.00
R1418:Asap2 UTSW 12 21,289,590 (GRCm39) missense probably damaging 1.00
R1418:Asap2 UTSW 12 21,289,586 (GRCm39) missense probably damaging 1.00
R1469:Asap2 UTSW 12 21,263,180 (GRCm39) missense probably benign 0.00
R1469:Asap2 UTSW 12 21,263,180 (GRCm39) missense probably benign 0.00
R1526:Asap2 UTSW 12 21,235,188 (GRCm39) missense probably damaging 1.00
R1542:Asap2 UTSW 12 21,315,998 (GRCm39) missense probably damaging 1.00
R1710:Asap2 UTSW 12 21,274,393 (GRCm39) missense probably damaging 1.00
R1750:Asap2 UTSW 12 21,253,999 (GRCm39) missense probably damaging 1.00
R2151:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2152:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2154:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2323:Asap2 UTSW 12 21,253,969 (GRCm39) missense probably damaging 1.00
R2378:Asap2 UTSW 12 21,304,319 (GRCm39) missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21,274,378 (GRCm39) missense probably damaging 1.00
R3757:Asap2 UTSW 12 21,317,767 (GRCm39) missense probably damaging 1.00
R4305:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4307:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4308:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4345:Asap2 UTSW 12 21,280,832 (GRCm39) missense probably damaging 1.00
R4525:Asap2 UTSW 12 21,279,293 (GRCm39) splice site probably null
R4562:Asap2 UTSW 12 21,162,094 (GRCm39) missense probably damaging 1.00
R4999:Asap2 UTSW 12 21,302,766 (GRCm39) missense probably benign 0.19
R5027:Asap2 UTSW 12 21,254,082 (GRCm39) missense probably damaging 1.00
R5221:Asap2 UTSW 12 21,263,191 (GRCm39) missense probably benign 0.14
R5645:Asap2 UTSW 12 21,315,983 (GRCm39) missense probably damaging 0.99
R5799:Asap2 UTSW 12 21,218,247 (GRCm39) missense probably damaging 1.00
R5876:Asap2 UTSW 12 21,262,810 (GRCm39) missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21,268,191 (GRCm39) missense probably damaging 1.00
R5912:Asap2 UTSW 12 21,256,344 (GRCm39) missense probably damaging 1.00
R6576:Asap2 UTSW 12 21,294,704 (GRCm39) missense probably damaging 1.00
R6896:Asap2 UTSW 12 21,315,526 (GRCm39) missense probably damaging 1.00
R6934:Asap2 UTSW 12 21,218,251 (GRCm39) missense probably damaging 1.00
R7134:Asap2 UTSW 12 21,315,964 (GRCm39) nonsense probably null
R7347:Asap2 UTSW 12 21,279,458 (GRCm39) missense probably benign 0.03
R7378:Asap2 UTSW 12 21,162,052 (GRCm39) missense probably benign 0.01
R7515:Asap2 UTSW 12 21,279,240 (GRCm39) missense possibly damaging 0.76
R8033:Asap2 UTSW 12 21,274,390 (GRCm39) missense probably damaging 1.00
R8793:Asap2 UTSW 12 21,218,212 (GRCm39) missense probably damaging 1.00
R8891:Asap2 UTSW 12 21,162,144 (GRCm39) missense probably damaging 1.00
R8972:Asap2 UTSW 12 21,279,249 (GRCm39) missense probably damaging 1.00
R9021:Asap2 UTSW 12 21,253,999 (GRCm39) missense possibly damaging 0.94
R9216:Asap2 UTSW 12 21,263,191 (GRCm39) missense probably benign 0.14
R9323:Asap2 UTSW 12 21,162,148 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGACCCCAGGTGTTTCATTTC -3'
(R):5'- GCAGCACCAGATCCAGATTGCTTAG -3'

Sequencing Primer
(F):5'- CCTCTGTGGGTTTCCGAGC -3'
(R):5'- AGAGCTTCCACTGTTCACAGG -3'
Posted On 2014-01-05