Mutagenetix > Incidental Mutation

Incidental Mutation 'R0981:Mtrf1'

97212

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R0981 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79401590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 54 (L54S)

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600]

AlphaFold

Q8K126

Predicted Effect

probably benign
Transcript: ENSMUST00000022600
AA Change: L54S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: L54S

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227610

Coding Region Coverage

1x: 99.5%
3x: 98.4%
10x: 95.4%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,520,331	C942S	probably damaging	Het
Alpk1	T	C	3: 127,679,402	N984S	possibly damaging	Het
Ankrd55	T	C	13: 112,323,076	V68A	possibly damaging	Het
Asap2	T	C	12: 21,265,960	S960P	probably damaging	Het
Atp2b1	T	A	10: 99,015,629	N66K	probably damaging	Het
Cckar	C	T	5: 53,706,290	G39R	probably damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Cpb1	C	A	3: 20,275,490	R24L	probably benign	Het
Dlg5	T	G	14: 24,154,631	R1258S	probably damaging	Het
Fam71e2	T	A	7: 4,757,589		probably null	Het
Fanci	A	G	7: 79,405,166	Q148R	probably benign	Het
Fcgbp	T	A	7: 28,085,110	Y198*	probably null	Het
Gapt	G	C	13: 110,353,739	T130R	probably damaging	Het
Glis1	A	G	4: 107,615,042	E272G	probably damaging	Het
Gm13741	T	C	2: 87,656,234	N229S	probably benign	Het
Gsdmc4	T	A	15: 63,892,073	I392F	probably damaging	Het
H2-M2	T	C	17: 37,482,630	T162A	probably benign	Het
Hk2	G	A	6: 82,743,968	R190W	probably damaging	Het
Irf1	T	C	11: 53,773,722	*52R	probably null	Het
Lman2l	T	A	1: 36,445,233	M1L	unknown	Het
Mgat1	C	T	11: 49,261,055	R122C	probably damaging	Het
Myo5c	A	T	9: 75,271,591	L676F	probably damaging	Het
Odf3	A	G	7: 140,848,295	M7V	probably benign	Het
Ofcc1	A	G	13: 40,072,698	I786T	probably damaging	Het
Olfr488	AGGT	A	7: 108,256,021		probably benign	Het
Olfr488	GGTAG	GG	7: 108,256,022		probably benign	Het
Pfn1	G	A	11: 70,652,138	R137C	probably benign	Het
Pgbd5	G	A	8: 124,384,293	R129*	probably null	Het
Pibf1	T	C	14: 99,150,743		probably null	Het
Pkd2l1	A	G	19: 44,154,422		probably null	Het
Plin5	C	A	17: 56,114,020	R215L	probably damaging	Het
Prrc2c	C	T	1: 162,705,981		probably benign	Het
Rnasel	T	G	1: 153,759,599	C608G	probably benign	Het
Slc28a2	T	A	2: 122,450,984	V218D	probably damaging	Het
Snx1	T	C	9: 66,109,559	I29V	probably benign	Het
Tenm3	A	G	8: 48,298,965	W939R	probably damaging	Het
Tmem237	C	A	1: 59,118,005	R15L	probably damaging	Het
Tmx3	T	C	18: 90,537,200	V347A	probably benign	Het
Vmn1r191	T	C	13: 22,179,219	T122A	probably benign	Het
Wdfy4	G	T	14: 33,147,092	N326K	probably benign	Het
Zfp408	A	G	2: 91,645,183	L642P	probably benign	Het
Zfp808	C	A	13: 62,171,673	H239N	possibly damaging	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R3883:Mtrf1	UTSW	14	79419267	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4748:Mtrf1	UTSW	14	79411650	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7095:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7182:Mtrf1	UTSW	14	79423464	missense	possibly damaging	0.60
R7254:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23
R9593:Mtrf1	UTSW	14	79419224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCTACTGAGATGAGTCATCACCTGTG -3'
(R):5'- AAGAGCCTGGACTCTTAGCAGACC -3'

Sequencing Primer
(F):5'- AGATGAGTCATCACCTGTGTATTTG -3'
(R):5'- tgggaggcagaggcaag -3'

Posted On

2014-01-05