Incidental Mutation 'R1116:Dyrk3'
ID97222
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131129182 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 418 (A418V)
Ref Sequence ENSEMBL: ENSMUSP00000016670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably damaging
Transcript: ENSMUST00000016670
AA Change: A418V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: A418V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189756
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Meta Mutation Damage Score 0.5553 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
PIT4576001:Dyrk3 UTSW 1 131130181 missense probably damaging 0.98
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R0724:Dyrk3 UTSW 1 131130140 missense probably benign 0.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
R7072:Dyrk3 UTSW 1 131129728 missense probably damaging 1.00
R7744:Dyrk3 UTSW 1 131129806 missense probably damaging 1.00
R7775:Dyrk3 UTSW 1 131129627 missense possibly damaging 0.84
R7909:Dyrk3 UTSW 1 131129587 missense probably damaging 1.00
R7961:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
R8009:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
R8298:Dyrk3 UTSW 1 131129375 missense probably damaging 1.00
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTCACCACAGCCCTTCAGTG -3'
(R):5'- AAGTTCGCCCAGTCCATCCTACAG -3'

Sequencing Primer
(F):5'- CGGTTGCCCAGTCTTTGC -3'
(R):5'- AAGGTCATCGACTTTGGCTC -3'
Posted On2014-01-05