Incidental Mutation 'R0981:Plin5'
ID97224
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Nameperilipin 5
SynonymsMLDP, Lsdp5, 2310076L09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0981 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56111601-56117596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56114020 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 215 (R215L)
Ref Sequence ENSEMBL: ENSMUSP00000108695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000019808] [ENSMUST00000113072] [ENSMUST00000190703]
Predicted Effect probably benign
Transcript: ENSMUST00000002908
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019808
AA Change: R215L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: R215L

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113072
AA Change: R215L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: R215L

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190703
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fam71e2 T A 7: 4,757,589 probably null Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Glis1 A G 4: 107,615,042 E272G probably damaging Het
Gm13741 T C 2: 87,656,234 N229S probably benign Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Ofcc1 A G 13: 40,072,698 I786T probably damaging Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Pkd2l1 A G 19: 44,154,422 probably null Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Plin5 UTSW 17 56115597 missense probably damaging 1.00
R1966:Plin5 UTSW 17 56112186 missense probably damaging 1.00
R2153:Plin5 UTSW 17 56116836 missense probably benign 0.02
R2368:Plin5 UTSW 17 56115588 missense probably damaging 1.00
R4809:Plin5 UTSW 17 56116855 missense probably benign 0.00
R5173:Plin5 UTSW 17 56115548 splice site probably null
R5315:Plin5 UTSW 17 56114066 missense probably benign 0.15
R5836:Plin5 UTSW 17 56115549 critical splice donor site probably null
R7129:Plin5 UTSW 17 56115174 missense probably null
R7510:Plin5 UTSW 17 56113975 missense probably damaging 0.97
R8305:Plin5 UTSW 17 56115221 missense probably benign 0.00
X0028:Plin5 UTSW 17 56116324 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATACTCAGTGAATGCCCCGC -3'
(R):5'- ACTACACTTCATAGGGTTTGGGGAAGG -3'

Sequencing Primer
(F):5'- GCCCTCAGCGATAGCCC -3'
(R):5'- AAAGGGGTCGATGTTGTATATCTG -3'
Posted On2014-01-05