Incidental Mutation 'R1116:Agps'
ID 97227
Institutional Source Beutler Lab
Gene Symbol Agps
Ensembl Gene ENSMUSG00000042410
Gene Name alkylglycerone phosphate synthase
Synonyms bs2, ADAPS, 9930035G10Rik
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 75832177-75931350 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 75861925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047232] [ENSMUST00000111952] [ENSMUST00000175646]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047232
SMART Domains Protein: ENSMUSP00000041967
Gene: ENSMUSG00000042410

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Pfam:FAD_binding_4 219 362 3.2e-43 PFAM
Pfam:FAD-oxidase_C 397 670 4.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111952
SMART Domains Protein: ENSMUSP00000107583
Gene: ENSMUSG00000042410

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Pfam:FAD_binding_4 219 362 4.7e-43 PFAM
Pfam:FAD-oxidase_C 397 508 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175646
SMART Domains Protein: ENSMUSP00000135457
Gene: ENSMUSG00000042410

DomainStartEndE-ValueType
Pfam:FAD_binding_4 116 259 1.2e-43 PFAM
Pfam:FAD-oxidase_C 294 567 2.6e-61 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the FAD-binding oxidoreductase/transferase type 4 family. It encodes a protein that catalyzes the second step of ether lipid biosynthesis in which acyl-dihydroxyacetonephosphate (DHAP) is converted to alkyl-DHAP by the addition of a long chain alcohol and the removal of a long-chain acid anion. The protein is localized to the inner aspect of the peroxisomal membrane and requires FAD as a cofactor. Mutations in this gene have been associated with rhizomelic chondrodysplasia punctata, type 3 and Zellweger syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit male infertility, azoospermia, microphthalmia, and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Agps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Agps APN 2 75925972 missense probably benign 0.00
IGL01373:Agps APN 2 75852784 missense probably benign 0.00
IGL01958:Agps APN 2 75909701 critical splice donor site probably null
IGL02691:Agps APN 2 75891860 missense probably benign 0.04
R0087:Agps UTSW 2 75909635 missense probably damaging 1.00
R0323:Agps UTSW 2 75894161 nonsense probably null
R1511:Agps UTSW 2 75866779 missense probably damaging 1.00
R2049:Agps UTSW 2 75858926 missense probably benign
R4770:Agps UTSW 2 75891855 missense possibly damaging 0.94
R5418:Agps UTSW 2 75858904 missense probably damaging 1.00
R5457:Agps UTSW 2 75854252 missense probably benign 0.01
R6795:Agps UTSW 2 75894058 missense probably damaging 0.98
R7286:Agps UTSW 2 75852784 missense probably benign 0.22
R7367:Agps UTSW 2 75868313 missense possibly damaging 0.67
R7529:Agps UTSW 2 75832352 missense possibly damaging 0.85
R7842:Agps UTSW 2 75851532 missense probably damaging 1.00
R8416:Agps UTSW 2 75854203 missense probably benign
R9149:Agps UTSW 2 75866838 missense probably damaging 0.99
R9261:Agps UTSW 2 75854506 intron probably benign
R9371:Agps UTSW 2 75911680 critical splice donor site probably null
R9393:Agps UTSW 2 75904912 missense possibly damaging 0.67
R9453:Agps UTSW 2 75832241 missense probably damaging 0.99
R9555:Agps UTSW 2 75852747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTGCTCTTGTTCAATGTCACAGC -3'
(R):5'- ATGCTACCCTGAAAGCTCCTGCAC -3'

Sequencing Primer
(F):5'- CTTGTTCAATGTCACAGCATAGAG -3'
(R):5'- gtctatttctccaactttctatccc -3'
Posted On 2014-01-05