Incidental Mutation 'R1116:Ehf'
ID 97229
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103263433-103303278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103267009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 231 (N231I)
Ref Sequence ENSEMBL: ENSMUSP00000106807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788]
AlphaFold O70273
Predicted Effect probably damaging
Transcript: ENSMUST00000090475
AA Change: N254I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: N254I

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111174
AA Change: N254I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: N254I

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111176
AA Change: N231I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350
AA Change: N231I

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125788
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Meta Mutation Damage Score 0.4444 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103266840 splice site probably null
IGL01296:Ehf APN 2 103268155 splice site probably null
IGL02095:Ehf APN 2 103266991 missense probably damaging 1.00
R0399:Ehf UTSW 2 103266870 missense probably damaging 1.00
R1728:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R1729:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R2240:Ehf UTSW 2 103274075 missense probably benign
R2287:Ehf UTSW 2 103267124 missense possibly damaging 0.89
R2397:Ehf UTSW 2 103276819 missense probably damaging 0.99
R4094:Ehf UTSW 2 103290750 intron probably benign
R4687:Ehf UTSW 2 103267126 missense probably damaging 1.00
R4930:Ehf UTSW 2 103266857 missense probably damaging 1.00
R5695:Ehf UTSW 2 103266779 missense probably damaging 1.00
R5925:Ehf UTSW 2 103266993 splice site probably null
R6656:Ehf UTSW 2 103283583 missense probably damaging 1.00
R8217:Ehf UTSW 2 103279631 missense possibly damaging 0.94
R9008:Ehf UTSW 2 103266828 missense
Z1176:Ehf UTSW 2 103279518 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTATAGACCAGCCGTCGTCCATCC -3'
(R):5'- ACTGGCTAAACCACTGAGATTCCCC -3'

Sequencing Primer
(F):5'- GTCCATCCACACGTTCCAGG -3'
(R):5'- TCTATATCTCAAGGCAGAGGCTG -3'
Posted On 2014-01-05