Incidental Mutation 'R1116:Ergic3'
ID 97233
Institutional Source Beutler Lab
Gene Symbol Ergic3
Ensembl Gene ENSMUSG00000005881
Gene Name ERGIC and golgi 3
Synonyms D2Ucla1, NY-BR-84, CGI-54, Sdbcag84, 2310015B14Rik
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 156008045-156018279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 156016787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 278 (V278M)
Ref Sequence ENSEMBL: ENSMUSP00000086025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
AlphaFold Q9CQE7
Predicted Effect probably benign
Transcript: ENSMUST00000006035
AA Change: V267M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881
AA Change: V267M

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088650
AA Change: V278M

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881
AA Change: V278M

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect unknown
Transcript: ENSMUST00000142859
AA Change: V200M
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881
AA Change: V200M

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152568
Predicted Effect unknown
Transcript: ENSMUST00000155370
AA Change: V142M
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881
AA Change: V142M

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Ergic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Ergic3 APN 2 156010475 missense probably benign
IGL02792:Ergic3 APN 2 156017850 missense probably damaging 1.00
R0128:Ergic3 UTSW 2 156011140 missense possibly damaging 0.79
R0389:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R0443:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R2005:Ergic3 UTSW 2 156011108 missense possibly damaging 0.85
R2230:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R2232:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R4975:Ergic3 UTSW 2 156017718 critical splice donor site probably null
R5103:Ergic3 UTSW 2 156008625 missense probably benign 0.37
R5285:Ergic3 UTSW 2 156018037 unclassified probably benign
R6624:Ergic3 UTSW 2 156016898 missense probably damaging 1.00
R6660:Ergic3 UTSW 2 156017834 missense probably damaging 1.00
R7094:Ergic3 UTSW 2 156016763 missense possibly damaging 0.85
R8948:Ergic3 UTSW 2 156011240 missense probably benign 0.29
R9155:Ergic3 UTSW 2 156008860 missense probably damaging 1.00
R9780:Ergic3 UTSW 2 156011244 nonsense probably null
X0027:Ergic3 UTSW 2 156008611 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGTACAGCCAGTCCTTCCATCATTG -3'
(R):5'- AGTTGTCCCCGTACTACCTGAACTC -3'

Sequencing Primer
(F):5'- CCCTGCATTGACAGACTCAG -3'
(R):5'- GTACTACCTGAACTCACCTCC -3'
Posted On 2014-01-05