Incidental Mutation 'R1116:Cryz'
ID 97243
Institutional Source Beutler Lab
Gene Symbol Cryz
Ensembl Gene ENSMUSG00000028199
Gene Name crystallin, zeta
Synonyms Sez9, quinone reductase, SEZ9
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 154596711-154623182 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 154621603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000135723] [ENSMUST00000155232] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
AlphaFold P47199
Predicted Effect probably benign
Transcript: ENSMUST00000029850
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155232
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195292
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Cryz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cryz APN 3 154604942 missense possibly damaging 0.95
IGL00838:Cryz APN 3 154618475 missense probably damaging 1.00
IGL00969:Cryz APN 3 154618526 nonsense probably null
IGL01571:Cryz APN 3 154621743 missense probably damaging 1.00
IGL03082:Cryz APN 3 154604926 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1586:Cryz UTSW 3 154611510 missense probably benign 0.00
R2018:Cryz UTSW 3 154621683 missense probably damaging 1.00
R2223:Cryz UTSW 3 154618554 missense possibly damaging 0.86
R2334:Cryz UTSW 3 154622191 missense probably benign 0.04
R4488:Cryz UTSW 3 154618457 splice site probably benign
R5547:Cryz UTSW 3 154611557 nonsense probably null
R5595:Cryz UTSW 3 154606518 missense probably damaging 1.00
R5917:Cryz UTSW 3 154621766 missense probably benign 0.05
R7197:Cryz UTSW 3 154621568 missense probably damaging 0.99
R7473:Cryz UTSW 3 154606520 missense probably benign
R8121:Cryz UTSW 3 154621745 missense probably benign 0.00
R9215:Cryz UTSW 3 154618809 missense probably benign 0.00
R9222:Cryz UTSW 3 154611566 missense probably benign 0.03
R9651:Cryz UTSW 3 154622128 missense probably benign 0.00
Z1176:Cryz UTSW 3 154621769 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGGTTTTACCGACTCTCGCC -3'
(R):5'- AGCTGTAACTGACTAGTGCTCCCTC -3'

Sequencing Primer
(F):5'- CTCCATCTTGTTCTTTTACCATGCAG -3'
(R):5'- CAGGTGACCTAGCTTAGCATGAC -3'
Posted On 2014-01-05