Incidental Mutation 'R0987:Olfr1156'
ID97244
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission 039107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0987 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87949547 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 229 (R229C)
Ref Sequence ENSEMBL: ENSMUSP00000149665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably benign
Transcript: ENSMUST00000099842
AA Change: R229C

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: R229C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215903
Predicted Effect probably benign
Transcript: ENSMUST00000216191
AA Change: R229C

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216726
AA Change: R229C

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,932 V16D possibly damaging Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Car6 A G 4: 150,197,343 I71T probably damaging Het
Crem A T 18: 3,288,060 S178T probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fcgbp G T 7: 28,094,174 C1167F probably damaging Het
Glipr1l1 A G 10: 112,078,435 S234G probably benign Het
Igsf9b T C 9: 27,332,553 probably null Het
Kif26b T C 1: 178,821,620 L435P probably damaging Het
Kirrel2 T C 7: 30,448,130 T698A probably damaging Het
Lrrc9 T C 12: 72,510,382 V1407A probably benign Het
Mau2 T C 8: 70,027,698 D275G probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Notch2 T C 3: 98,134,677 probably null Het
Nr0b2 G A 4: 133,556,192 V247I probably benign Het
Olfr1066 A T 2: 86,455,547 C241* probably null Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Pigf A G 17: 86,997,545 L190P probably damaging Het
Rasef A T 4: 73,734,484 C593* probably null Het
Tex15 T G 8: 33,576,847 W2102G probably damaging Het
Tmbim1 T C 1: 74,293,924 probably null Het
Tmem183a A T 1: 134,352,371 F257Y probably damaging Het
Zbtb11 A G 16: 55,990,708 T410A probably benign Het
Zzef1 TGCGTGGGAACCCGC TGC 11: 72,901,333 probably benign Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R8222:Olfr1156 UTSW 2 87949444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTTCAGCATGGGAATGATCACAG -3'
(R):5'- TGTCATCATGTCCCCAAAGCTCCG -3'

Sequencing Primer
(F):5'- TCAGCATGGGAATGATCACAGTATAG -3'
(R):5'- AAAGCTCCGTCTTGTACTGG -3'
Posted On2014-01-05