Incidental Mutation 'R1116:Fabp3'
ID 97247
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Name fatty acid binding protein 3, muscle and heart
Synonyms Fabph4, Mdgi, H-FABP, Fabp3, Fabph1, Fabph-4, Fabph-1
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 130308595-130315463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130312387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000070709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
AlphaFold P11404
Predicted Effect probably benign
Transcript: ENSMUST00000070532
AA Change: T57I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: T57I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.7568 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130312387 missense probably benign 0.21
R1111:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1112:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1114:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1144:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1460:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1505:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1506:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1508:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1509:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1582:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1601:Fabp3 UTSW 4 130308848 missense probably benign 0.24
R1612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1641:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1664:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1670:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1686:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1690:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1709:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1854:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1855:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1935:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2107:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2208:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2211:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2392:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2393:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2829:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2830:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2831:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2901:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2964:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2975:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2979:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2980:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2981:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2982:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2983:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3430:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3613:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3614:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3755:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3756:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3825:Fabp3 UTSW 4 130312452 splice site probably null
R3842:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4012:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4280:Fabp3 UTSW 4 130312452 splice site probably null
R4282:Fabp3 UTSW 4 130312452 splice site probably null
R4405:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4406:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4466:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4503:Fabp3 UTSW 4 130312452 splice site probably null
R4547:Fabp3 UTSW 4 130312452 splice site probably null
R4548:Fabp3 UTSW 4 130312452 splice site probably null
R4671:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4681:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4710:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4743:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4850:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4989:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5015:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5133:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5134:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5549:Fabp3 UTSW 4 130315225 makesense probably null
R5884:Fabp3 UTSW 4 130312338 missense probably benign 0.01
R7170:Fabp3 UTSW 4 130313970 missense probably benign 0.06
R7967:Fabp3 UTSW 4 130313988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAAAATCTTCCAGGGGCAGGAC -3'
(R):5'- GCAGCACTGAGCAGGCTTTATGAAC -3'

Sequencing Primer
(F):5'- CAAAGACGTGGGCCACTG -3'
(R):5'- AGGCTTTATGAACCTGCCC -3'
Posted On 2014-01-05