Incidental Mutation 'R1116:Acad10'
ID 97257
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Name acyl-Coenzyme A dehydrogenase family, member 10
Synonyms 2410021P16Rik
MMRRC Submission 039189-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 121759089-121798577 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121768814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 717 (F717S)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
AlphaFold Q8K370
Predicted Effect probably damaging
Transcript: ENSMUST00000031412
AA Change: F717S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: F717S

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111770
AA Change: F717S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: F717S

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143187
Meta Mutation Damage Score 0.9443 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,506,792 (GRCm39) probably benign Het
Acacb C T 5: 114,349,017 (GRCm39) P1028S probably damaging Het
Adgrg6 A T 10: 14,314,172 (GRCm39) Y705N probably benign Het
Adm A G 7: 110,227,501 (GRCm39) I6V probably benign Het
Agps T G 2: 75,692,269 (GRCm39) probably benign Het
Atr C T 9: 95,749,689 (GRCm39) Q501* probably null Het
Cacna2d3 A G 14: 28,786,278 (GRCm39) probably benign Het
Ccnt1 G A 15: 98,442,219 (GRCm39) R350W probably damaging Het
Cfap74 G A 4: 155,518,453 (GRCm39) E564K probably benign Het
Clip1 T C 5: 123,717,554 (GRCm39) E1250G probably damaging Het
Cryz A C 3: 154,327,240 (GRCm39) probably benign Het
Dnah1 C A 14: 31,029,824 (GRCm39) V494F probably benign Het
Dpep3 G T 8: 106,705,461 (GRCm39) D96E probably damaging Het
Dyrk3 G A 1: 131,056,919 (GRCm39) A418V probably damaging Het
Ehf T A 2: 103,097,354 (GRCm39) N231I probably damaging Het
Eif4g3 T C 4: 137,819,086 (GRCm39) probably null Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam178b A T 1: 36,617,669 (GRCm39) C82* probably null Het
Gm1647 C T 3: 69,064,205 (GRCm39) Q31* probably null Het
Got1 T A 19: 43,491,413 (GRCm39) K346* probably null Het
Grid2ip G A 5: 143,368,669 (GRCm39) G656D possibly damaging Het
Grm2 A G 9: 106,525,126 (GRCm39) Y530H probably damaging Het
Hyou1 T C 9: 44,295,978 (GRCm39) I381T probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Marchf11 T C 15: 26,409,381 (GRCm39) L360P probably damaging Het
Mettl17 T C 14: 52,127,055 (GRCm39) V281A probably benign Het
Micu2 A T 14: 58,191,657 (GRCm39) D131E probably benign Het
Mug1 G C 6: 121,847,604 (GRCm39) V661L probably benign Het
Myo18b A T 5: 112,951,145 (GRCm39) D1488E probably damaging Het
Nkg7 G A 7: 43,086,878 (GRCm39) V51I probably benign Het
Nlgn1 A C 3: 25,488,038 (GRCm39) S766A probably benign Het
Or4d2b T A 11: 87,780,234 (GRCm39) M163L probably benign Het
Otog T C 7: 45,950,025 (GRCm39) probably benign Het
Pax2 T C 19: 44,745,863 (GRCm39) S11P probably damaging Het
Pck2 A G 14: 55,782,823 (GRCm39) D392G probably benign Het
Plxnd1 A T 6: 115,943,966 (GRCm39) probably null Het
Prkdc A G 16: 15,600,943 (GRCm39) D2868G probably benign Het
Prl3d2 T C 13: 27,309,985 (GRCm39) L149P probably damaging Het
Purg A T 8: 33,876,773 (GRCm39) H137L probably benign Het
Slc38a8 A T 8: 120,222,872 (GRCm39) L150Q probably damaging Het
Tifab T A 13: 56,324,025 (GRCm39) R139S possibly damaging Het
Txndc16 T C 14: 45,400,442 (GRCm39) H353R probably benign Het
Ulbp3 A T 10: 3,070,180 (GRCm39) noncoding transcript Het
Upk2 A G 9: 44,365,086 (GRCm39) probably null Het
Zdhhc25 G A 15: 88,484,823 (GRCm39) V53I probably benign Het
Zfp738 T A 13: 67,818,362 (GRCm39) probably null Het
Zfp810 C T 9: 22,190,381 (GRCm39) E176K probably benign Het
Zfp846 T A 9: 20,504,559 (GRCm39) W140R possibly damaging Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121,760,106 (GRCm39) missense probably damaging 1.00
IGL02469:Acad10 APN 5 121,783,522 (GRCm39) missense probably damaging 1.00
IGL02526:Acad10 APN 5 121,784,923 (GRCm39) missense probably damaging 0.99
IGL02623:Acad10 APN 5 121,767,993 (GRCm39) missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121,769,633 (GRCm39) missense probably benign
IGL02685:Acad10 APN 5 121,770,672 (GRCm39) missense probably benign
IGL03139:Acad10 APN 5 121,764,145 (GRCm39) missense probably benign
IGL03267:Acad10 APN 5 121,775,412 (GRCm39) missense probably benign 0.34
P0026:Acad10 UTSW 5 121,775,415 (GRCm39) missense probably damaging 1.00
R0099:Acad10 UTSW 5 121,759,353 (GRCm39) missense probably damaging 1.00
R0453:Acad10 UTSW 5 121,765,445 (GRCm39) nonsense probably null
R1051:Acad10 UTSW 5 121,764,143 (GRCm39) missense probably damaging 0.97
R1052:Acad10 UTSW 5 121,787,604 (GRCm39) missense possibly damaging 0.65
R1548:Acad10 UTSW 5 121,764,104 (GRCm39) splice site probably benign
R1548:Acad10 UTSW 5 121,764,103 (GRCm39) splice site probably benign
R1571:Acad10 UTSW 5 121,759,411 (GRCm39) missense probably damaging 0.99
R1592:Acad10 UTSW 5 121,783,444 (GRCm39) missense probably damaging 0.99
R1741:Acad10 UTSW 5 121,785,899 (GRCm39) missense probably damaging 1.00
R1789:Acad10 UTSW 5 121,769,456 (GRCm39) missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121,764,248 (GRCm39) missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121,772,814 (GRCm39) missense probably damaging 1.00
R2085:Acad10 UTSW 5 121,787,523 (GRCm39) missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121,767,990 (GRCm39) missense probably benign 0.23
R2511:Acad10 UTSW 5 121,769,630 (GRCm39) missense probably benign 0.02
R2570:Acad10 UTSW 5 121,768,267 (GRCm39) missense probably damaging 1.00
R3824:Acad10 UTSW 5 121,760,881 (GRCm39) missense probably benign
R3846:Acad10 UTSW 5 121,772,749 (GRCm39) missense probably benign 0.19
R4106:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R4107:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R4108:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R5569:Acad10 UTSW 5 121,764,143 (GRCm39) missense probably damaging 0.97
R5704:Acad10 UTSW 5 121,769,606 (GRCm39) missense probably benign 0.03
R5845:Acad10 UTSW 5 121,764,146 (GRCm39) missense probably benign
R5990:Acad10 UTSW 5 121,783,468 (GRCm39) missense probably damaging 1.00
R6019:Acad10 UTSW 5 121,772,864 (GRCm39) missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121,760,096 (GRCm39) missense probably damaging 0.97
R6384:Acad10 UTSW 5 121,790,066 (GRCm39) missense probably benign 0.43
R6491:Acad10 UTSW 5 121,768,220 (GRCm39) missense probably damaging 1.00
R6608:Acad10 UTSW 5 121,770,555 (GRCm39) missense probably benign 0.02
R6941:Acad10 UTSW 5 121,787,420 (GRCm39) missense probably damaging 1.00
R7221:Acad10 UTSW 5 121,768,273 (GRCm39) missense probably damaging 1.00
R7283:Acad10 UTSW 5 121,787,538 (GRCm39) missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121,768,780 (GRCm39) nonsense probably null
R7483:Acad10 UTSW 5 121,794,075 (GRCm39) critical splice donor site probably null
R7553:Acad10 UTSW 5 121,777,318 (GRCm39) missense probably damaging 1.00
R7721:Acad10 UTSW 5 121,784,929 (GRCm39) splice site probably null
R8075:Acad10 UTSW 5 121,790,148 (GRCm39) missense probably benign 0.00
R8400:Acad10 UTSW 5 121,764,268 (GRCm39) missense possibly damaging 0.82
R9171:Acad10 UTSW 5 121,767,981 (GRCm39) missense probably benign 0.14
X0061:Acad10 UTSW 5 121,760,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTTTCCACATGCAGTGGTTTC -3'
(R):5'- CCTCAAGGTAAGCCAGCCTTTCAG -3'

Sequencing Primer
(F):5'- CATGCAGTGGTTTCTGCTGG -3'
(R):5'- tcctccctcttctgcctc -3'
Posted On 2014-01-05