Mutagenetix > Incidental Mutation

Incidental Mutation 'R1116:Clip1'

97259

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

039189-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1116 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123579491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1250 (E1250G)

Ref Sequence

ENSEMBL: ENSMUSP00000068241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566]

AlphaFold

Q922J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000031382
AA Change: E1367G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: E1367G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000063905
AA Change: E1250G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: E1250G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111561
AA Change: E1356G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: E1356G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111564
AA Change: E1245G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: E1245G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111566
AA Change: E1321G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: E1321G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125340

Predicted Effect

unknown
Transcript: ENSMUST00000137363
AA Change: E995G

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: E995G

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137602

Predicted Effect

unknown
Transcript: ENSMUST00000154672
AA Change: E1168G

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: E1168G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198833

Meta Mutation Damage Score

0.1147

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	A	T	10: 3,120,180		noncoding transcript	Het
Abi3bp	T	C	16: 56,686,429		probably benign	Het
Acacb	C	T	5: 114,210,956	P1028S	probably damaging	Het
Acad10	A	G	5: 121,630,751	F717S	probably damaging	Het
Adgrg6	A	T	10: 14,438,428	Y705N	probably benign	Het
Adm	A	G	7: 110,628,294	I6V	probably benign	Het
Agps	T	G	2: 75,861,925		probably benign	Het
Atr	C	T	9: 95,867,636	Q501*	probably null	Het
Cacna2d3	A	G	14: 29,064,321		probably benign	Het
Ccnt1	G	A	15: 98,544,338	R350W	probably damaging	Het
Cfap74	G	A	4: 155,433,996	E564K	probably benign	Het
Cryz	A	C	3: 154,621,603		probably benign	Het
Dnah1	C	A	14: 31,307,867	V494F	probably benign	Het
Dpep3	G	T	8: 105,978,829	D96E	probably damaging	Het
Dyrk3	G	A	1: 131,129,182	A418V	probably damaging	Het
Ehf	T	A	2: 103,267,009	N231I	probably damaging	Het
Eif4g3	T	C	4: 138,091,775		probably null	Het
Ergic3	G	A	2: 156,016,787	V278M	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam178b	A	T	1: 36,578,588	C82*	probably null	Het
Gm1647	C	T	3: 69,156,872	Q31*	probably null	Het
Got1	T	A	19: 43,502,974	K346*	probably null	Het
Grid2ip	G	A	5: 143,382,914	G656D	possibly damaging	Het
Grm2	A	G	9: 106,647,927	Y530H	probably damaging	Het
Hyou1	T	C	9: 44,384,681	I381T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
March11	T	C	15: 26,409,295	L360P	probably damaging	Het
Mettl17	T	C	14: 51,889,598	V281A	probably benign	Het
Micu2	A	T	14: 57,954,200	D131E	probably benign	Het
Mug1	G	C	6: 121,870,645	V661L	probably benign	Het
Myo18b	A	T	5: 112,803,279	D1488E	probably damaging	Het
Nkg7	G	A	7: 43,437,454	V51I	probably benign	Het
Nlgn1	A	C	3: 25,433,874	S766A	probably benign	Het
Olfr462	T	A	11: 87,889,408	M163L	probably benign	Het
Otog	T	C	7: 46,300,601		probably benign	Het
Pax2	T	C	19: 44,757,424	S11P	probably damaging	Het
Pck2	A	G	14: 55,545,366	D392G	probably benign	Het
Plxnd1	A	T	6: 115,967,005		probably null	Het
Prkdc	A	G	16: 15,783,079	D2868G	probably benign	Het
Prl3d2	T	C	13: 27,126,002	L149P	probably damaging	Het
Purg	A	T	8: 33,386,745	H137L	probably benign	Het
Slc38a8	A	T	8: 119,496,133	L150Q	probably damaging	Het
Tifab	T	A	13: 56,176,212	R139S	possibly damaging	Het
Txndc16	T	C	14: 45,162,985	H353R	probably benign	Het
Upk2	A	G	9: 44,453,789		probably null	Het
Zdhhc25	G	A	15: 88,600,620	V53I	probably benign	Het
Zfp738	T	A	13: 67,670,243		probably null	Het
Zfp810	C	T	9: 22,279,085	E176K	probably benign	Het
Zfp846	T	A	9: 20,593,263	W140R	possibly damaging	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGCCCAGTGCCCAAACATCTC -3'
(R):5'- TCAATGGTCAGCGTCTCTAGCAGC -3'

Sequencing Primer
(F):5'- ATCTCACAGATCTCACAGTATGG -3'
(R):5'- gccagaagagggcatcag -3'

Posted On

2014-01-05