Incidental Mutation 'R1116:Otog'
ID 97273
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Name otogelin
Synonyms Otgn
MMRRC Submission 039189-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.770) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45890411-45960858 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 45950025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538] [ENSMUST00000209802]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000164538
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209802
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,506,792 (GRCm39) probably benign Het
Acacb C T 5: 114,349,017 (GRCm39) P1028S probably damaging Het
Acad10 A G 5: 121,768,814 (GRCm39) F717S probably damaging Het
Adgrg6 A T 10: 14,314,172 (GRCm39) Y705N probably benign Het
Adm A G 7: 110,227,501 (GRCm39) I6V probably benign Het
Agps T G 2: 75,692,269 (GRCm39) probably benign Het
Atr C T 9: 95,749,689 (GRCm39) Q501* probably null Het
Cacna2d3 A G 14: 28,786,278 (GRCm39) probably benign Het
Ccnt1 G A 15: 98,442,219 (GRCm39) R350W probably damaging Het
Cfap74 G A 4: 155,518,453 (GRCm39) E564K probably benign Het
Clip1 T C 5: 123,717,554 (GRCm39) E1250G probably damaging Het
Cryz A C 3: 154,327,240 (GRCm39) probably benign Het
Dnah1 C A 14: 31,029,824 (GRCm39) V494F probably benign Het
Dpep3 G T 8: 106,705,461 (GRCm39) D96E probably damaging Het
Dyrk3 G A 1: 131,056,919 (GRCm39) A418V probably damaging Het
Ehf T A 2: 103,097,354 (GRCm39) N231I probably damaging Het
Eif4g3 T C 4: 137,819,086 (GRCm39) probably null Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam178b A T 1: 36,617,669 (GRCm39) C82* probably null Het
Gm1647 C T 3: 69,064,205 (GRCm39) Q31* probably null Het
Got1 T A 19: 43,491,413 (GRCm39) K346* probably null Het
Grid2ip G A 5: 143,368,669 (GRCm39) G656D possibly damaging Het
Grm2 A G 9: 106,525,126 (GRCm39) Y530H probably damaging Het
Hyou1 T C 9: 44,295,978 (GRCm39) I381T probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Marchf11 T C 15: 26,409,381 (GRCm39) L360P probably damaging Het
Mettl17 T C 14: 52,127,055 (GRCm39) V281A probably benign Het
Micu2 A T 14: 58,191,657 (GRCm39) D131E probably benign Het
Mug1 G C 6: 121,847,604 (GRCm39) V661L probably benign Het
Myo18b A T 5: 112,951,145 (GRCm39) D1488E probably damaging Het
Nkg7 G A 7: 43,086,878 (GRCm39) V51I probably benign Het
Nlgn1 A C 3: 25,488,038 (GRCm39) S766A probably benign Het
Or4d2b T A 11: 87,780,234 (GRCm39) M163L probably benign Het
Pax2 T C 19: 44,745,863 (GRCm39) S11P probably damaging Het
Pck2 A G 14: 55,782,823 (GRCm39) D392G probably benign Het
Plxnd1 A T 6: 115,943,966 (GRCm39) probably null Het
Prkdc A G 16: 15,600,943 (GRCm39) D2868G probably benign Het
Prl3d2 T C 13: 27,309,985 (GRCm39) L149P probably damaging Het
Purg A T 8: 33,876,773 (GRCm39) H137L probably benign Het
Slc38a8 A T 8: 120,222,872 (GRCm39) L150Q probably damaging Het
Tifab T A 13: 56,324,025 (GRCm39) R139S possibly damaging Het
Txndc16 T C 14: 45,400,442 (GRCm39) H353R probably benign Het
Ulbp3 A T 10: 3,070,180 (GRCm39) noncoding transcript Het
Upk2 A G 9: 44,365,086 (GRCm39) probably null Het
Zdhhc25 G A 15: 88,484,823 (GRCm39) V53I probably benign Het
Zfp738 T A 13: 67,818,362 (GRCm39) probably null Het
Zfp810 C T 9: 22,190,381 (GRCm39) E176K probably benign Het
Zfp846 T A 9: 20,504,559 (GRCm39) W140R possibly damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 45,900,706 (GRCm39) missense probably damaging 1.00
IGL00725:Otog APN 7 45,923,516 (GRCm39) missense probably damaging 1.00
IGL00757:Otog APN 7 45,939,552 (GRCm39) missense probably damaging 1.00
IGL00822:Otog APN 7 45,945,304 (GRCm39) missense probably benign 0.24
IGL01354:Otog APN 7 45,939,150 (GRCm39) missense probably damaging 1.00
IGL01567:Otog APN 7 45,926,039 (GRCm39) splice site probably benign
IGL02034:Otog APN 7 45,945,417 (GRCm39) nonsense probably null
IGL02090:Otog APN 7 45,949,571 (GRCm39) missense probably damaging 1.00
IGL02132:Otog APN 7 45,954,903 (GRCm39) missense probably damaging 0.99
IGL02148:Otog APN 7 45,950,011 (GRCm39) missense probably damaging 1.00
IGL02173:Otog APN 7 45,926,165 (GRCm39) splice site probably benign
IGL02199:Otog APN 7 45,926,775 (GRCm39) missense possibly damaging 0.90
IGL02216:Otog APN 7 45,950,892 (GRCm39) missense probably damaging 1.00
IGL02322:Otog APN 7 45,950,881 (GRCm39) missense probably benign 0.01
IGL02330:Otog APN 7 45,937,493 (GRCm39) missense possibly damaging 0.84
IGL02529:Otog APN 7 45,909,381 (GRCm39) missense probably damaging 0.99
IGL02898:Otog APN 7 45,959,562 (GRCm39) missense probably damaging 1.00
IGL02970:Otog APN 7 45,945,291 (GRCm39) missense probably benign 0.11
IGL03085:Otog APN 7 45,955,346 (GRCm39) critical splice donor site probably null
IGL03108:Otog APN 7 45,900,762 (GRCm39) missense probably damaging 1.00
IGL03275:Otog APN 7 45,955,654 (GRCm39) missense probably damaging 1.00
R0282_Otog_616 UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0636_otog_678 UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R1029_otog_141 UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
BB010:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
BB020:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
I1329:Otog UTSW 7 45,895,927 (GRCm39) missense probably benign 0.02
IGL02984:Otog UTSW 7 45,954,932 (GRCm39) missense probably damaging 0.98
PIT4472001:Otog UTSW 7 45,945,273 (GRCm39) missense probably damaging 1.00
R0032:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0032:Otog UTSW 7 45,937,637 (GRCm39) nonsense probably null
R0105:Otog UTSW 7 45,937,790 (GRCm39) missense possibly damaging 0.79
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0165:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0166:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0167:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0282:Otog UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0392:Otog UTSW 7 45,899,499 (GRCm39) missense probably benign 0.00
R0436:Otog UTSW 7 45,915,360 (GRCm39) splice site probably benign
R0441:Otog UTSW 7 45,955,301 (GRCm39) missense probably damaging 1.00
R0499:Otog UTSW 7 45,923,256 (GRCm39) missense probably damaging 1.00
R0530:Otog UTSW 7 45,947,668 (GRCm39) missense probably damaging 0.98
R0541:Otog UTSW 7 45,918,673 (GRCm39) splice site probably benign
R0600:Otog UTSW 7 45,900,819 (GRCm39) splice site probably benign
R0626:Otog UTSW 7 45,920,797 (GRCm39) missense possibly damaging 0.95
R0636:Otog UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R0764:Otog UTSW 7 45,949,918 (GRCm39) missense probably benign 0.00
R0833:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0836:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0844:Otog UTSW 7 45,937,252 (GRCm39) missense possibly damaging 0.53
R1029:Otog UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
R1134:Otog UTSW 7 45,947,938 (GRCm39) missense probably damaging 1.00
R1183:Otog UTSW 7 45,939,179 (GRCm39) missense probably benign 0.41
R1204:Otog UTSW 7 45,909,335 (GRCm39) missense probably benign 0.16
R1301:Otog UTSW 7 45,939,113 (GRCm39) missense probably damaging 1.00
R1344:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1384:Otog UTSW 7 45,923,119 (GRCm39) splice site probably benign
R1418:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1432:Otog UTSW 7 45,950,007 (GRCm39) missense probably damaging 1.00
R1479:Otog UTSW 7 45,945,402 (GRCm39) missense possibly damaging 0.75
R1521:Otog UTSW 7 45,908,688 (GRCm39) missense possibly damaging 0.71
R1589:Otog UTSW 7 45,933,332 (GRCm39) missense probably benign 0.18
R1671:Otog UTSW 7 45,911,210 (GRCm39) missense probably damaging 1.00
R1773:Otog UTSW 7 45,937,583 (GRCm39) missense probably benign 0.28
R1806:Otog UTSW 7 45,940,361 (GRCm39) critical splice acceptor site probably null
R1843:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1873:Otog UTSW 7 45,918,767 (GRCm39) missense probably damaging 1.00
R1923:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1927:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R2008:Otog UTSW 7 45,913,498 (GRCm39) missense probably benign 0.43
R2048:Otog UTSW 7 45,937,063 (GRCm39) missense probably damaging 1.00
R2131:Otog UTSW 7 45,899,524 (GRCm39) missense probably damaging 1.00
R2153:Otog UTSW 7 45,952,328 (GRCm39) missense probably damaging 1.00
R2240:Otog UTSW 7 45,890,453 (GRCm39) start codon destroyed probably null
R2278:Otog UTSW 7 45,949,468 (GRCm39) missense probably damaging 1.00
R2407:Otog UTSW 7 45,890,964 (GRCm39) missense probably benign 0.10
R2424:Otog UTSW 7 45,947,593 (GRCm39) nonsense probably null
R2513:Otog UTSW 7 45,955,014 (GRCm39) critical splice donor site probably null
R2863:Otog UTSW 7 45,918,730 (GRCm39) missense probably damaging 1.00
R3148:Otog UTSW 7 45,939,593 (GRCm39) missense probably damaging 1.00
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3733:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3734:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3855:Otog UTSW 7 45,923,184 (GRCm39) missense possibly damaging 0.65
R3880:Otog UTSW 7 45,937,445 (GRCm39) missense possibly damaging 0.93
R4081:Otog UTSW 7 45,937,723 (GRCm39) missense possibly damaging 0.92
R4349:Otog UTSW 7 45,923,613 (GRCm39) missense probably damaging 0.99
R4382:Otog UTSW 7 45,939,122 (GRCm39) missense probably damaging 1.00
R4392:Otog UTSW 7 45,934,548 (GRCm39) missense probably damaging 0.98
R4520:Otog UTSW 7 45,890,477 (GRCm39) unclassified probably benign
R4569:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R4580:Otog UTSW 7 45,937,225 (GRCm39) missense possibly damaging 0.78
R4672:Otog UTSW 7 45,939,210 (GRCm39) missense probably damaging 0.98
R4764:Otog UTSW 7 45,937,943 (GRCm39) missense probably benign 0.29
R4910:Otog UTSW 7 45,947,958 (GRCm39) missense probably damaging 1.00
R4910:Otog UTSW 7 45,913,486 (GRCm39) missense probably damaging 1.00
R4913:Otog UTSW 7 45,913,526 (GRCm39) missense probably benign 0.31
R4975:Otog UTSW 7 45,937,415 (GRCm39) missense probably benign 0.00
R4996:Otog UTSW 7 45,954,934 (GRCm39) nonsense probably null
R4996:Otog UTSW 7 45,948,030 (GRCm39) missense possibly damaging 0.51
R5116:Otog UTSW 7 45,923,191 (GRCm39) missense probably benign 0.34
R5138:Otog UTSW 7 45,899,430 (GRCm39) missense possibly damaging 0.61
R5169:Otog UTSW 7 45,947,572 (GRCm39) missense probably benign 0.06
R5239:Otog UTSW 7 45,936,859 (GRCm39) missense probably benign 0.15
R5277:Otog UTSW 7 45,896,045 (GRCm39) missense possibly damaging 0.89
R5287:Otog UTSW 7 45,918,753 (GRCm39) missense probably damaging 0.98
R5299:Otog UTSW 7 45,938,275 (GRCm39) missense probably benign 0.16
R5378:Otog UTSW 7 45,904,428 (GRCm39) missense probably damaging 1.00
R5382:Otog UTSW 7 45,898,428 (GRCm39) missense probably damaging 1.00
R5487:Otog UTSW 7 45,938,192 (GRCm39) missense probably benign 0.27
R5507:Otog UTSW 7 45,911,123 (GRCm39) missense probably damaging 1.00
R5517:Otog UTSW 7 45,923,995 (GRCm39) missense probably damaging 1.00
R5643:Otog UTSW 7 45,936,871 (GRCm39) missense probably damaging 1.00
R5757:Otog UTSW 7 45,890,545 (GRCm39) critical splice donor site probably null
R5910:Otog UTSW 7 45,948,022 (GRCm39) missense possibly damaging 0.94
R6019:Otog UTSW 7 45,938,374 (GRCm39) missense probably benign 0.00
R6150:Otog UTSW 7 45,913,483 (GRCm39) missense possibly damaging 0.82
R6225:Otog UTSW 7 45,898,458 (GRCm39) missense possibly damaging 0.67
R6271:Otog UTSW 7 45,901,464 (GRCm39) missense probably damaging 1.00
R6317:Otog UTSW 7 45,950,639 (GRCm39) missense probably damaging 1.00
R6454:Otog UTSW 7 45,955,241 (GRCm39) missense probably damaging 1.00
R6640:Otog UTSW 7 45,911,167 (GRCm39) missense possibly damaging 0.92
R6753:Otog UTSW 7 45,898,495 (GRCm39) missense probably benign 0.06
R6788:Otog UTSW 7 45,947,741 (GRCm39) missense probably damaging 1.00
R6859:Otog UTSW 7 45,923,205 (GRCm39) missense probably damaging 0.96
R7033:Otog UTSW 7 45,916,822 (GRCm39) critical splice donor site probably null
R7071:Otog UTSW 7 45,916,747 (GRCm39) missense probably damaging 1.00
R7084:Otog UTSW 7 45,947,990 (GRCm39) nonsense probably null
R7116:Otog UTSW 7 45,947,689 (GRCm39) missense probably damaging 0.99
R7202:Otog UTSW 7 45,937,474 (GRCm39) missense probably damaging 0.97
R7365:Otog UTSW 7 45,947,732 (GRCm39) missense probably damaging 1.00
R7468:Otog UTSW 7 45,913,543 (GRCm39) missense probably benign
R7475:Otog UTSW 7 45,916,700 (GRCm39) missense probably damaging 0.99
R7502:Otog UTSW 7 45,948,039 (GRCm39) missense probably damaging 1.00
R7558:Otog UTSW 7 45,952,584 (GRCm39) missense probably damaging 0.99
R7577:Otog UTSW 7 45,937,279 (GRCm39) missense possibly damaging 0.62
R7651:Otog UTSW 7 45,891,185 (GRCm39) missense probably benign 0.00
R7689:Otog UTSW 7 45,901,480 (GRCm39) missense probably damaging 1.00
R7806:Otog UTSW 7 45,935,200 (GRCm39) missense probably benign
R7933:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R8021:Otog UTSW 7 45,916,766 (GRCm39) missense probably damaging 0.98
R8082:Otog UTSW 7 45,939,143 (GRCm39) missense probably damaging 1.00
R8531:Otog UTSW 7 45,901,473 (GRCm39) missense probably damaging 0.99
R8772:Otog UTSW 7 45,934,352 (GRCm39) missense probably damaging 1.00
R8816:Otog UTSW 7 45,950,905 (GRCm39) missense possibly damaging 0.92
R8842:Otog UTSW 7 45,895,948 (GRCm39) missense probably damaging 1.00
R8987:Otog UTSW 7 45,936,878 (GRCm39) missense probably benign 0.43
R8988:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R9010:Otog UTSW 7 45,949,894 (GRCm39) missense probably benign 0.00
R9025:Otog UTSW 7 45,937,520 (GRCm39) missense probably benign 0.13
R9131:Otog UTSW 7 45,952,597 (GRCm39) nonsense probably null
R9179:Otog UTSW 7 45,937,885 (GRCm39) missense possibly damaging 0.65
R9334:Otog UTSW 7 45,909,353 (GRCm39) missense possibly damaging 0.95
R9365:Otog UTSW 7 45,920,688 (GRCm39) missense probably damaging 1.00
R9408:Otog UTSW 7 45,916,721 (GRCm39) missense possibly damaging 0.79
R9418:Otog UTSW 7 45,938,024 (GRCm39) missense probably benign 0.41
R9465:Otog UTSW 7 45,955,299 (GRCm39) missense possibly damaging 0.80
R9496:Otog UTSW 7 45,890,505 (GRCm39) missense unknown
R9632:Otog UTSW 7 45,915,143 (GRCm39) missense probably benign 0.27
R9656:Otog UTSW 7 45,959,567 (GRCm39) missense probably damaging 1.00
RF024:Otog UTSW 7 45,937,093 (GRCm39) missense probably damaging 1.00
X0062:Otog UTSW 7 45,909,345 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,939,164 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,923,962 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,912,276 (GRCm39) missense possibly damaging 0.80
Z1177:Otog UTSW 7 45,959,409 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAGACCCTGTGCCCTAATAC -3'
(R):5'- TCTTTACGCAGCCGAGTCGTTAC -3'

Sequencing Primer
(F):5'- CTGGAACAGCTCCCTCAGTG -3'
(R):5'- GAGCTGACTAGGATAATGTCCCC -3'
Posted On 2014-01-05