Incidental Mutation 'R1116:Adm'
ID 97275
Institutional Source Beutler Lab
Gene Symbol Adm
Ensembl Gene ENSMUSG00000030790
Gene Name adrenomedullin
Synonyms AM
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 110627661-110629820 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110628294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000033054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033054]
AlphaFold P97297
Predicted Effect probably benign
Transcript: ENSMUST00000033054
AA Change: I6V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033054
Gene: ENSMUSG00000030790
AA Change: I6V

DomainStartEndE-ValueType
Pfam:Calc_CGRP_IAPP 1 149 2.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186888
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a preprohormone which is cleaved to form two biologically active peptides, adrenomedullin and proadrenomedullin N-terminal 20 peptide. Adrenomedullin is a 52 aa peptide with several functions, including vasodilation, regulation of hormone secretion, promotion of angiogenesis, and antimicrobial activity. The antimicrobial activity is antibacterial, as the peptide has been shown to kill E. coli and S. aureus at low concentration. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiovascular defects, hyrdops fetalis, and lethality at midgestation with defects in placental defects, impaired fetal blood vessel and materal spiral artery remodeling, and decreased uterine NK cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Adm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Adm APN 7 110628581 missense probably damaging 1.00
IGL01950:Adm APN 7 110628900 missense probably damaging 1.00
IGL01965:Adm APN 7 110628625 missense probably benign 0.04
PIT4696001:Adm UTSW 7 110628289 missense probably benign 0.36
R0497:Adm UTSW 7 110629121 missense probably benign
R0630:Adm UTSW 7 110628548 missense probably damaging 1.00
R0879:Adm UTSW 7 110628352 missense possibly damaging 0.93
R1595:Adm UTSW 7 110629091 missense probably damaging 1.00
R4880:Adm UTSW 7 110629119 missense probably benign 0.01
R5992:Adm UTSW 7 110627696 start gained probably benign
R6296:Adm UTSW 7 110628354 missense probably benign 0.00
R6387:Adm UTSW 7 110628295 missense possibly damaging 0.74
R7181:Adm UTSW 7 110629029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGGCACTTCTCAATGGCTTC -3'
(R):5'- AACTGTCGTCTCATCAGCGAGTCC -3'

Sequencing Primer
(F):5'- GCGCAAAAATCTCCGGTG -3'
(R):5'- AGTTCAAGTGATGTCCCAGC -3'
Posted On 2014-01-05