Incidental Mutation 'R1116:Purg'
ID 97281
Institutional Source Beutler Lab
Gene Symbol Purg
Ensembl Gene ENSMUSG00000049184
Gene Name purine-rich element binding protein G
Synonyms 4930486B15Rik
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 33386325-33417467 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33386745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 137 (H137L)
Ref Sequence ENSEMBL: ENSMUSP00000077205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000070340] [ENSMUST00000078058]
AlphaFold Q8R4E6
Predicted Effect probably benign
Transcript: ENSMUST00000033990
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070340
AA Change: H137L

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065002
Gene: ENSMUSG00000049184
AA Change: H137L

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
PUR 62 130 3.39e-16 SMART
PUR 173 247 1.25e-19 SMART
PUR 264 325 1.66e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078058
AA Change: H137L

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077205
Gene: ENSMUSG00000049184
AA Change: H137L

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
PUR 62 130 3.39e-16 SMART
PUR 173 247 1.25e-19 SMART
PUR 264 317 2.1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known, however, its encoded product is highly similar to purine-rich element binding protein A. The latter is a DNA-binding protein which binds preferentially to the single strand of the purine-rich element termed PUR, and has been implicated in the control of both DNA replication and transcription. This gene lies in close proximity to the Werner syndrome gene, but on the opposite strand, on chromosome 8p11. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Purg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Purg APN 8 33386603 missense probably damaging 0.99
R1185:Purg UTSW 8 33386869 nonsense probably null
R1185:Purg UTSW 8 33386869 nonsense probably null
R1185:Purg UTSW 8 33386869 nonsense probably null
R2945:Purg UTSW 8 33386643 missense probably damaging 1.00
R3859:Purg UTSW 8 33386559 missense possibly damaging 0.75
R4016:Purg UTSW 8 33386991 nonsense probably null
R4296:Purg UTSW 8 33387293 missense probably damaging 1.00
R4854:Purg UTSW 8 33387314 missense possibly damaging 0.93
R5928:Purg UTSW 8 33386952 missense probably benign 0.00
R6337:Purg UTSW 8 33386423 missense possibly damaging 0.53
R7580:Purg UTSW 8 33416633 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCCTCCAAACGTGTGGACATC -3'
(R):5'- AGTAACCGATCATGCCAGTGCC -3'

Sequencing Primer
(F):5'- TTTTACCTAGACGTGAAGCAGAGC -3'
(R):5'- TGTCTAATCCTTAGGAAGCGACC -3'
Posted On 2014-01-05