Incidental Mutation 'R1116:Slc38a8'
ID97285
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Namesolute carrier family 38, member 8
SynonymsLOC234788
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119479602-119501698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119496133 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 150 (L150Q)
Ref Sequence ENSEMBL: ENSMUSP00000119987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748] [ENSMUST00000133821] [ENSMUST00000138061]
Predicted Effect probably damaging
Transcript: ENSMUST00000036748
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224
AA Change: L150Q

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132838
SMART Domains Protein: ENSMUSP00000121251
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 39 289 1.1e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133821
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123094
Gene: ENSMUSG00000034224
AA Change: L150Q

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 22 163 2.1e-10 PFAM
Pfam:Aa_trans 22 165 3.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138061
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224
AA Change: L150Q

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Meta Mutation Damage Score 0.8319 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 119494219 missense probably benign 0.01
IGL02167:Slc38a8 APN 8 119487360 missense probably benign 0.03
IGL02565:Slc38a8 APN 8 119485561 missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 119485543 missense probably benign 0.34
IGL03177:Slc38a8 APN 8 119485512 missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 119499716 missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 119482655 missense probably benign
R2247:Slc38a8 UTSW 8 119485650 missense probably benign 0.00
R4964:Slc38a8 UTSW 8 119482684 splice site probably null
R5294:Slc38a8 UTSW 8 119494289 missense probably damaging 1.00
R5303:Slc38a8 UTSW 8 119486041 missense possibly damaging 0.66
R5430:Slc38a8 UTSW 8 119494220 missense probably benign 0.16
R5643:Slc38a8 UTSW 8 119480749 makesense probably null
R6016:Slc38a8 UTSW 8 119494305 splice site probably null
R7346:Slc38a8 UTSW 8 119499815 nonsense probably null
R7425:Slc38a8 UTSW 8 119485588 missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 119501081 missense possibly damaging 0.60
R8081:Slc38a8 UTSW 8 119485530 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTCAATTTTGCCCATGACAACCAGG -3'
(R):5'- TGATCCCTTTACTCCAGGCTGACTTAG -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- AGGCTGACTTAGCCCCC -3'
Posted On2014-01-05