Incidental Mutation 'R1116:Zfp846'
ID 97287
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Name zinc finger protein 846
Synonyms 2210010B09Rik
MMRRC Submission 039189-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20492595-20516706 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20504559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 140 (W140R)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
AlphaFold G3X996
Predicted Effect possibly damaging
Transcript: ENSMUST00000060063
AA Change: W140R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: W140R

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115557
AA Change: W140R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: W140R

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217655
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,506,792 (GRCm39) probably benign Het
Acacb C T 5: 114,349,017 (GRCm39) P1028S probably damaging Het
Acad10 A G 5: 121,768,814 (GRCm39) F717S probably damaging Het
Adgrg6 A T 10: 14,314,172 (GRCm39) Y705N probably benign Het
Adm A G 7: 110,227,501 (GRCm39) I6V probably benign Het
Agps T G 2: 75,692,269 (GRCm39) probably benign Het
Atr C T 9: 95,749,689 (GRCm39) Q501* probably null Het
Cacna2d3 A G 14: 28,786,278 (GRCm39) probably benign Het
Ccnt1 G A 15: 98,442,219 (GRCm39) R350W probably damaging Het
Cfap74 G A 4: 155,518,453 (GRCm39) E564K probably benign Het
Clip1 T C 5: 123,717,554 (GRCm39) E1250G probably damaging Het
Cryz A C 3: 154,327,240 (GRCm39) probably benign Het
Dnah1 C A 14: 31,029,824 (GRCm39) V494F probably benign Het
Dpep3 G T 8: 106,705,461 (GRCm39) D96E probably damaging Het
Dyrk3 G A 1: 131,056,919 (GRCm39) A418V probably damaging Het
Ehf T A 2: 103,097,354 (GRCm39) N231I probably damaging Het
Eif4g3 T C 4: 137,819,086 (GRCm39) probably null Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam178b A T 1: 36,617,669 (GRCm39) C82* probably null Het
Gm1647 C T 3: 69,064,205 (GRCm39) Q31* probably null Het
Got1 T A 19: 43,491,413 (GRCm39) K346* probably null Het
Grid2ip G A 5: 143,368,669 (GRCm39) G656D possibly damaging Het
Grm2 A G 9: 106,525,126 (GRCm39) Y530H probably damaging Het
Hyou1 T C 9: 44,295,978 (GRCm39) I381T probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Marchf11 T C 15: 26,409,381 (GRCm39) L360P probably damaging Het
Mettl17 T C 14: 52,127,055 (GRCm39) V281A probably benign Het
Micu2 A T 14: 58,191,657 (GRCm39) D131E probably benign Het
Mug1 G C 6: 121,847,604 (GRCm39) V661L probably benign Het
Myo18b A T 5: 112,951,145 (GRCm39) D1488E probably damaging Het
Nkg7 G A 7: 43,086,878 (GRCm39) V51I probably benign Het
Nlgn1 A C 3: 25,488,038 (GRCm39) S766A probably benign Het
Or4d2b T A 11: 87,780,234 (GRCm39) M163L probably benign Het
Otog T C 7: 45,950,025 (GRCm39) probably benign Het
Pax2 T C 19: 44,745,863 (GRCm39) S11P probably damaging Het
Pck2 A G 14: 55,782,823 (GRCm39) D392G probably benign Het
Plxnd1 A T 6: 115,943,966 (GRCm39) probably null Het
Prkdc A G 16: 15,600,943 (GRCm39) D2868G probably benign Het
Prl3d2 T C 13: 27,309,985 (GRCm39) L149P probably damaging Het
Purg A T 8: 33,876,773 (GRCm39) H137L probably benign Het
Slc38a8 A T 8: 120,222,872 (GRCm39) L150Q probably damaging Het
Tifab T A 13: 56,324,025 (GRCm39) R139S possibly damaging Het
Txndc16 T C 14: 45,400,442 (GRCm39) H353R probably benign Het
Ulbp3 A T 10: 3,070,180 (GRCm39) noncoding transcript Het
Upk2 A G 9: 44,365,086 (GRCm39) probably null Het
Zdhhc25 G A 15: 88,484,823 (GRCm39) V53I probably benign Het
Zfp738 T A 13: 67,818,362 (GRCm39) probably null Het
Zfp810 C T 9: 22,190,381 (GRCm39) E176K probably benign Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20,499,905 (GRCm39) missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20,499,796 (GRCm39) splice site probably benign
R0077:Zfp846 UTSW 9 20,505,303 (GRCm39) missense probably benign 0.00
R0528:Zfp846 UTSW 9 20,499,224 (GRCm39) splice site probably benign
R0675:Zfp846 UTSW 9 20,504,853 (GRCm39) missense probably benign
R1439:Zfp846 UTSW 9 20,505,393 (GRCm39) missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20,505,735 (GRCm39) missense probably benign
R4586:Zfp846 UTSW 9 20,504,809 (GRCm39) missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20,502,111 (GRCm39) missense probably benign
R6221:Zfp846 UTSW 9 20,504,591 (GRCm39) missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20,505,016 (GRCm39) missense possibly damaging 0.93
R6420:Zfp846 UTSW 9 20,505,007 (GRCm39) missense probably damaging 1.00
R6526:Zfp846 UTSW 9 20,505,167 (GRCm39) missense probably benign 0.23
R7003:Zfp846 UTSW 9 20,499,188 (GRCm39) start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20,505,521 (GRCm39) missense probably benign 0.00
R7651:Zfp846 UTSW 9 20,499,808 (GRCm39) missense possibly damaging 0.86
R8254:Zfp846 UTSW 9 20,504,587 (GRCm39) missense probably benign
R8724:Zfp846 UTSW 9 20,505,352 (GRCm39) missense possibly damaging 0.88
R8997:Zfp846 UTSW 9 20,505,726 (GRCm39) missense probably benign 0.41
R9045:Zfp846 UTSW 9 20,505,189 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGGAGGGAGTCCTGCTTATAGTCAA -3'
(R):5'- TATATGCTGACTAAGGCGTGGGGATGA -3'

Sequencing Primer
(F):5'- GGAGTCCTGCTTATAGTCAAAATGG -3'
(R):5'- agttctaaagtgttccactagcc -3'
Posted On 2014-01-05