Incidental Mutation 'R1116:Zfp846'
ID97287
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Namezinc finger protein 846
Synonyms
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20581291-20605409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20593263 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 140 (W140R)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060063
AA Change: W140R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: W140R

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115557
AA Change: W140R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: W140R

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217655
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20588609 missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20588500 splice site probably benign
R0077:Zfp846 UTSW 9 20594007 missense probably benign 0.00
R0528:Zfp846 UTSW 9 20587928 splice site probably benign
R0675:Zfp846 UTSW 9 20593557 missense probably benign
R1439:Zfp846 UTSW 9 20594097 missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20594439 missense probably benign
R4586:Zfp846 UTSW 9 20593513 missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20590815 missense probably benign
R6221:Zfp846 UTSW 9 20593295 missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20593720 missense possibly damaging 0.93
R6420:Zfp846 UTSW 9 20593711 missense probably damaging 1.00
R6526:Zfp846 UTSW 9 20593871 missense probably benign 0.23
R7003:Zfp846 UTSW 9 20587892 start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20594225 missense probably benign 0.00
R7651:Zfp846 UTSW 9 20588512 missense possibly damaging 0.86
R8254:Zfp846 UTSW 9 20593291 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGGAGGGAGTCCTGCTTATAGTCAA -3'
(R):5'- TATATGCTGACTAAGGCGTGGGGATGA -3'

Sequencing Primer
(F):5'- GGAGTCCTGCTTATAGTCAAAATGG -3'
(R):5'- agttctaaagtgttccactagcc -3'
Posted On2014-01-05