Incidental Mutation 'R1116:Hyou1'
ID 97291
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 039189-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44295978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 381 (I381T)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: I381T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: I381T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: I381T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: I381T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: I381T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: I381T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217019
Meta Mutation Damage Score 0.9028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,506,792 (GRCm39) probably benign Het
Acacb C T 5: 114,349,017 (GRCm39) P1028S probably damaging Het
Acad10 A G 5: 121,768,814 (GRCm39) F717S probably damaging Het
Adgrg6 A T 10: 14,314,172 (GRCm39) Y705N probably benign Het
Adm A G 7: 110,227,501 (GRCm39) I6V probably benign Het
Agps T G 2: 75,692,269 (GRCm39) probably benign Het
Atr C T 9: 95,749,689 (GRCm39) Q501* probably null Het
Cacna2d3 A G 14: 28,786,278 (GRCm39) probably benign Het
Ccnt1 G A 15: 98,442,219 (GRCm39) R350W probably damaging Het
Cfap74 G A 4: 155,518,453 (GRCm39) E564K probably benign Het
Clip1 T C 5: 123,717,554 (GRCm39) E1250G probably damaging Het
Cryz A C 3: 154,327,240 (GRCm39) probably benign Het
Dnah1 C A 14: 31,029,824 (GRCm39) V494F probably benign Het
Dpep3 G T 8: 106,705,461 (GRCm39) D96E probably damaging Het
Dyrk3 G A 1: 131,056,919 (GRCm39) A418V probably damaging Het
Ehf T A 2: 103,097,354 (GRCm39) N231I probably damaging Het
Eif4g3 T C 4: 137,819,086 (GRCm39) probably null Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam178b A T 1: 36,617,669 (GRCm39) C82* probably null Het
Gm1647 C T 3: 69,064,205 (GRCm39) Q31* probably null Het
Got1 T A 19: 43,491,413 (GRCm39) K346* probably null Het
Grid2ip G A 5: 143,368,669 (GRCm39) G656D possibly damaging Het
Grm2 A G 9: 106,525,126 (GRCm39) Y530H probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Marchf11 T C 15: 26,409,381 (GRCm39) L360P probably damaging Het
Mettl17 T C 14: 52,127,055 (GRCm39) V281A probably benign Het
Micu2 A T 14: 58,191,657 (GRCm39) D131E probably benign Het
Mug1 G C 6: 121,847,604 (GRCm39) V661L probably benign Het
Myo18b A T 5: 112,951,145 (GRCm39) D1488E probably damaging Het
Nkg7 G A 7: 43,086,878 (GRCm39) V51I probably benign Het
Nlgn1 A C 3: 25,488,038 (GRCm39) S766A probably benign Het
Or4d2b T A 11: 87,780,234 (GRCm39) M163L probably benign Het
Otog T C 7: 45,950,025 (GRCm39) probably benign Het
Pax2 T C 19: 44,745,863 (GRCm39) S11P probably damaging Het
Pck2 A G 14: 55,782,823 (GRCm39) D392G probably benign Het
Plxnd1 A T 6: 115,943,966 (GRCm39) probably null Het
Prkdc A G 16: 15,600,943 (GRCm39) D2868G probably benign Het
Prl3d2 T C 13: 27,309,985 (GRCm39) L149P probably damaging Het
Purg A T 8: 33,876,773 (GRCm39) H137L probably benign Het
Slc38a8 A T 8: 120,222,872 (GRCm39) L150Q probably damaging Het
Tifab T A 13: 56,324,025 (GRCm39) R139S possibly damaging Het
Txndc16 T C 14: 45,400,442 (GRCm39) H353R probably benign Het
Ulbp3 A T 10: 3,070,180 (GRCm39) noncoding transcript Het
Upk2 A G 9: 44,365,086 (GRCm39) probably null Het
Zdhhc25 G A 15: 88,484,823 (GRCm39) V53I probably benign Het
Zfp738 T A 13: 67,818,362 (GRCm39) probably null Het
Zfp810 C T 9: 22,190,381 (GRCm39) E176K probably benign Het
Zfp846 T A 9: 20,504,559 (GRCm39) W140R possibly damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGCCCAGAGAGCAGACCTGAC -3'
(R):5'- ATCCCAGTGGAGAAGTGGAGTGTC -3'

Sequencing Primer
(F):5'- TTCAAGGCCAAAGTAACTCGG -3'
(R):5'- GTGTCACCAGGTCAAGCTTAC -3'
Posted On 2014-01-05