Incidental Mutation 'R0987:Glipr1l1'
ID97296
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene NameGLI pathogenesis-related 1 like 1
Synonyms1700011E04Rik
MMRRC Submission 039107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0987 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112060189-112078510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112078435 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 234 (S234G)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020434] [ENSMUST00000073617] [ENSMUST00000148897]
Predicted Effect probably benign
Transcript: ENSMUST00000020434
SMART Domains Protein: ENSMUSP00000020434
Gene: ENSMUSG00000020214

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
SCP 49 199 7.3e-30 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 303 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073617
AA Change: S234G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: S234G

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148897
SMART Domains Protein: ENSMUSP00000122771
Gene: ENSMUSG00000020214

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
SCP 49 199 7.3e-30 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 87.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,932 V16D possibly damaging Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Car6 A G 4: 150,197,343 I71T probably damaging Het
Crem A T 18: 3,288,060 S178T probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fcgbp G T 7: 28,094,174 C1167F probably damaging Het
Igsf9b T C 9: 27,332,553 probably null Het
Kif26b T C 1: 178,821,620 L435P probably damaging Het
Kirrel2 T C 7: 30,448,130 T698A probably damaging Het
Lrrc9 T C 12: 72,510,382 V1407A probably benign Het
Mau2 T C 8: 70,027,698 D275G probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Notch2 T C 3: 98,134,677 probably null Het
Nr0b2 G A 4: 133,556,192 V247I probably benign Het
Olfr1066 A T 2: 86,455,547 C241* probably null Het
Olfr1156 G A 2: 87,949,547 R229C probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Pigf A G 17: 86,997,545 L190P probably damaging Het
Rasef A T 4: 73,734,484 C593* probably null Het
Tex15 T G 8: 33,576,847 W2102G probably damaging Het
Tmbim1 T C 1: 74,293,924 probably null Het
Tmem183a A T 1: 134,352,371 F257Y probably damaging Het
Zbtb11 A G 16: 55,990,708 T410A probably benign Het
Zzef1 TGCGTGGGAACCCGC TGC 11: 72,901,333 probably benign Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0992:Glipr1l1 UTSW 10 112062325 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 112062338 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 112076170 missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 112078390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTGGGCTTCTGAACATTGCCTTT -3'
(R):5'- CCAAAACACCAGATCAATgcagatgac -3'

Sequencing Primer
(F):5'- GGCTTCTGAACATTGCCTTTTATTG -3'
(R):5'- aaatagtctgaaaatgaggtggtg -3'
Posted On2014-01-05