Incidental Mutation 'R1116:Olfr462'
ID97313
Institutional Source Beutler Lab
Gene Symbol Olfr462
Ensembl Gene ENSMUSG00000093839
Gene Nameolfactory receptor 462
SynonymsMOR240-3, GA_x6K02T2PAEV-9536824-9535889
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87884979-87892268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87889408 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 163 (M163L)
Ref Sequence ENSEMBL: ENSMUSP00000150179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049743] [ENSMUST00000081417] [ENSMUST00000213672] [ENSMUST00000213928] [ENSMUST00000215150] [ENSMUST00000217095]
Predicted Effect probably benign
Transcript: ENSMUST00000049743
AA Change: M163L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055334
Gene: ENSMUSG00000093839
AA Change: M163L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.2e-40 PFAM
Pfam:7tm_1 41 287 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081417
SMART Domains Protein: ENSMUSP00000080146
Gene: ENSMUSG00000093920

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.3e-41 PFAM
Pfam:7tm_1 41 287 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213672
AA Change: M163L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213928
AA Change: M163L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215150
Predicted Effect probably benign
Transcript: ENSMUST00000217095
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Olfr462
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0613:Olfr462 UTSW 11 87889227 missense possibly damaging 0.90
R1371:Olfr462 UTSW 11 87889296 missense probably damaging 1.00
R1415:Olfr462 UTSW 11 87889647 missense possibly damaging 0.91
R1444:Olfr462 UTSW 11 87889759 missense probably benign 0.00
R4591:Olfr462 UTSW 11 87889549 missense probably benign 0.35
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R5019:Olfr462 UTSW 11 87888975 missense probably benign
R5521:Olfr462 UTSW 11 87889719 missense probably damaging 0.99
R6967:Olfr462 UTSW 11 87889498 missense probably benign 0.02
R7186:Olfr462 UTSW 11 87889765 missense possibly damaging 0.69
R8025:Olfr462 UTSW 11 87888951 critical splice donor site probably null
R8245:Olfr462 UTSW 11 87889617 missense probably damaging 1.00
R8918:Olfr462 UTSW 11 87889458 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGTGAGACCTCAGCATCACCAG -3'
(R):5'- AGGCTCCACACACCTATGTACTTCC -3'

Sequencing Primer
(F):5'- CATCACCAGGATGACCAAGTAGG -3'
(R):5'- GGACTTCCTCTCTGAGAAGAAGAC -3'
Posted On2014-01-05