Incidental Mutation 'R0987:Pigf'
ID97328
Institutional Source Beutler Lab
Gene Symbol Pigf
Ensembl Gene ENSMUSG00000024145
Gene Namephosphatidylinositol glycan anchor biosynthesis, class F
Synonyms
MMRRC Submission 039107-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0987 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location86997256-87025406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86997545 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 190 (L190P)
Ref Sequence ENSEMBL: ENSMUSP00000024957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024956] [ENSMUST00000024957] [ENSMUST00000139344]
Predicted Effect probably benign
Transcript: ENSMUST00000024956
SMART Domains Protein: ENSMUSP00000024956
Gene: ENSMUSG00000024143

DomainStartEndE-ValueType
RHO 12 185 5.31e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000024957
AA Change: L190P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024957
Gene: ENSMUSG00000024145
AA Change: L190P

DomainStartEndE-ValueType
Pfam:PIG-F 21 204 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139344
SMART Domains Protein: ENSMUSP00000116780
Gene: ENSMUSG00000024143

DomainStartEndE-ValueType
RHO 12 153 1.91e-84 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,932 V16D possibly damaging Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Car6 A G 4: 150,197,343 I71T probably damaging Het
Crem A T 18: 3,288,060 S178T probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fcgbp G T 7: 28,094,174 C1167F probably damaging Het
Glipr1l1 A G 10: 112,078,435 S234G probably benign Het
Igsf9b T C 9: 27,332,553 probably null Het
Kif26b T C 1: 178,821,620 L435P probably damaging Het
Kirrel2 T C 7: 30,448,130 T698A probably damaging Het
Lrrc9 T C 12: 72,510,382 V1407A probably benign Het
Mau2 T C 8: 70,027,698 D275G probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Notch2 T C 3: 98,134,677 probably null Het
Nr0b2 G A 4: 133,556,192 V247I probably benign Het
Olfr1066 A T 2: 86,455,547 C241* probably null Het
Olfr1156 G A 2: 87,949,547 R229C probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Rasef A T 4: 73,734,484 C593* probably null Het
Tex15 T G 8: 33,576,847 W2102G probably damaging Het
Tmbim1 T C 1: 74,293,924 probably null Het
Tmem183a A T 1: 134,352,371 F257Y probably damaging Het
Zbtb11 A G 16: 55,990,708 T410A probably benign Het
Zzef1 TGCGTGGGAACCCGC TGC 11: 72,901,333 probably benign Het
Other mutations in Pigf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pigf APN 17 87020448 missense probably null 0.41
IGL01484:Pigf APN 17 87008880 missense probably benign 0.04
R0506:Pigf UTSW 17 87008909 missense probably benign 0.00
R0684:Pigf UTSW 17 87020495 missense probably benign 0.31
R4295:Pigf UTSW 17 87023756 missense probably benign 0.00
R5365:Pigf UTSW 17 87023708 missense possibly damaging 0.62
R6287:Pigf UTSW 17 86997539 missense probably damaging 1.00
R8420:Pigf UTSW 17 87020482 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTGCACAGCCCTTATGGAATC -3'
(R):5'- GAGAGTTTCTGAGAATCGGTCAGCC -3'

Sequencing Primer
(F):5'- GCCCTTATGGAATCTGCACAG -3'
(R):5'- TACAGTTGCCAGAAGCCTTG -3'
Posted On2014-01-05