Mutagenetix > Incidental Mutation

Incidental Mutation 'R1116:Dnah1'

97333

Institutional Source

Beutler Lab

Gene Symbol

Dnah1

Ensembl Gene

ENSMUSG00000019027

Gene Name

dynein, axonemal, heavy chain 1

Synonyms

E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik

MMRRC Submission

039189-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1116 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31260375-31323896 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 31307867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 494 (V494F)

Ref Sequence

ENSEMBL: ENSMUSP00000043281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048603]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048603
AA Change: V494F

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: V494F

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DHC_N2	998	1404	6.3e-146	PFAM
AAA	1558	1697	6.02e-1	SMART
AAA	1839	2077	4.66e0	SMART
low complexity region	2149	2157	N/A	INTRINSIC
AAA	2204	2353	2.35e-1	SMART
Pfam:AAA_8	2533	2803	7.7e-84	PFAM
Pfam:MT	2815	3165	9.9e-57	PFAM
Pfam:AAA_9	3185	3410	1.1e-93	PFAM
Pfam:Dynein_heavy	3545	4246	2.7e-275	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228755

Meta Mutation Damage Score

0.3292

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	A	T	10: 3,120,180		noncoding transcript	Het
Abi3bp	T	C	16: 56,686,429		probably benign	Het
Acacb	C	T	5: 114,210,956	P1028S	probably damaging	Het
Acad10	A	G	5: 121,630,751	F717S	probably damaging	Het
Adgrg6	A	T	10: 14,438,428	Y705N	probably benign	Het
Adm	A	G	7: 110,628,294	I6V	probably benign	Het
Agps	T	G	2: 75,861,925		probably benign	Het
Atr	C	T	9: 95,867,636	Q501*	probably null	Het
Cacna2d3	A	G	14: 29,064,321		probably benign	Het
Ccnt1	G	A	15: 98,544,338	R350W	probably damaging	Het
Cfap74	G	A	4: 155,433,996	E564K	probably benign	Het
Clip1	T	C	5: 123,579,491	E1250G	probably damaging	Het
Cryz	A	C	3: 154,621,603		probably benign	Het
Dpep3	G	T	8: 105,978,829	D96E	probably damaging	Het
Dyrk3	G	A	1: 131,129,182	A418V	probably damaging	Het
Ehf	T	A	2: 103,267,009	N231I	probably damaging	Het
Eif4g3	T	C	4: 138,091,775		probably null	Het
Ergic3	G	A	2: 156,016,787	V278M	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam178b	A	T	1: 36,578,588	C82*	probably null	Het
Gm1647	C	T	3: 69,156,872	Q31*	probably null	Het
Got1	T	A	19: 43,502,974	K346*	probably null	Het
Grid2ip	G	A	5: 143,382,914	G656D	possibly damaging	Het
Grm2	A	G	9: 106,647,927	Y530H	probably damaging	Het
Hyou1	T	C	9: 44,384,681	I381T	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
March11	T	C	15: 26,409,295	L360P	probably damaging	Het
Mettl17	T	C	14: 51,889,598	V281A	probably benign	Het
Micu2	A	T	14: 57,954,200	D131E	probably benign	Het
Mug1	G	C	6: 121,870,645	V661L	probably benign	Het
Myo18b	A	T	5: 112,803,279	D1488E	probably damaging	Het
Nkg7	G	A	7: 43,437,454	V51I	probably benign	Het
Nlgn1	A	C	3: 25,433,874	S766A	probably benign	Het
Olfr462	T	A	11: 87,889,408	M163L	probably benign	Het
Otog	T	C	7: 46,300,601		probably benign	Het
Pax2	T	C	19: 44,757,424	S11P	probably damaging	Het
Pck2	A	G	14: 55,545,366	D392G	probably benign	Het
Plxnd1	A	T	6: 115,967,005		probably null	Het
Prkdc	A	G	16: 15,783,079	D2868G	probably benign	Het
Prl3d2	T	C	13: 27,126,002	L149P	probably damaging	Het
Purg	A	T	8: 33,386,745	H137L	probably benign	Het
Slc38a8	A	T	8: 119,496,133	L150Q	probably damaging	Het
Tifab	T	A	13: 56,176,212	R139S	possibly damaging	Het
Txndc16	T	C	14: 45,162,985	H353R	probably benign	Het
Upk2	A	G	9: 44,453,789		probably null	Het
Zdhhc25	G	A	15: 88,600,620	V53I	probably benign	Het
Zfp738	T	A	13: 67,670,243		probably null	Het
Zfp810	C	T	9: 22,279,085	E176K	probably benign	Het
Zfp846	T	A	9: 20,593,263	W140R	possibly damaging	Het

Other mutations in Dnah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Dnah1	APN	14	31287873	missense	probably benign	0.01
IGL00227:Dnah1	APN	14	31286896	missense	probably damaging	1.00
IGL00491:Dnah1	APN	14	31261839	missense	probably damaging	1.00
IGL00787:Dnah1	APN	14	31300063	missense	possibly damaging	0.91
IGL00809:Dnah1	APN	14	31300809	nonsense	probably null
IGL00911:Dnah1	APN	14	31304434	splice site	probably null
IGL00949:Dnah1	APN	14	31307090	missense	probably benign	0.00
IGL00976:Dnah1	APN	14	31278138	missense	probably damaging	1.00
IGL01484:Dnah1	APN	14	31299940	missense	probably damaging	0.98
IGL01629:Dnah1	APN	14	31292320	missense	probably damaging	1.00
IGL01716:Dnah1	APN	14	31263378	missense	probably benign	0.34
IGL01893:Dnah1	APN	14	31266470	missense	probably damaging	1.00
IGL01933:Dnah1	APN	14	31310915	missense	probably benign	0.40
IGL01938:Dnah1	APN	14	31283887	missense	probably benign
IGL02032:Dnah1	APN	14	31274369	missense	probably benign
IGL02052:Dnah1	APN	14	31268786	missense	probably damaging	0.99
IGL02097:Dnah1	APN	14	31305001	missense	possibly damaging	0.92
IGL02127:Dnah1	APN	14	31304928	missense	probably benign	0.00
IGL02143:Dnah1	APN	14	31283289	missense	probably damaging	1.00
IGL02158:Dnah1	APN	14	31300967	missense	probably benign	0.00
IGL02442:Dnah1	APN	14	31287878	missense	probably damaging	1.00
IGL02525:Dnah1	APN	14	31305833	missense	probably benign	0.05
IGL02558:Dnah1	APN	14	31274379	missense	possibly damaging	0.96
IGL02633:Dnah1	APN	14	31284815	missense	probably benign	0.05
IGL02720:Dnah1	APN	14	31262220	missense	probably damaging	0.96
IGL02728:Dnah1	APN	14	31283998	missense	probably benign	0.44
IGL02738:Dnah1	APN	14	31292640	missense	probably benign	0.27
IGL02863:Dnah1	APN	14	31295293	missense	probably damaging	0.99
IGL02944:Dnah1	APN	14	31300871	missense	possibly damaging	0.88
IGL03110:Dnah1	APN	14	31266717	missense	probably benign	0.40
IGL03201:Dnah1	APN	14	31300949	missense	probably benign	0.13
IGL03215:Dnah1	APN	14	31274391	missense	probably damaging	1.00
IGL03230:Dnah1	APN	14	31270066	missense	probably damaging	1.00
IGL03248:Dnah1	APN	14	31269889	missense	probably damaging	1.00
IGL03267:Dnah1	APN	14	31286588	missense	probably benign	0.00
IGL03299:Dnah1	APN	14	31315122	nonsense	probably null
IGL03301:Dnah1	APN	14	31292692	missense	probably damaging	1.00
ergonomic	UTSW	14	31300748	missense	possibly damaging	0.91
Faraday	UTSW	14	31310882	missense	probably null	0.05
K3955:Dnah1	UTSW	14	31266459	missense	probably benign
PIT1430001:Dnah1	UTSW	14	31262580	missense	probably damaging	1.00
PIT4382001:Dnah1	UTSW	14	31284455	missense	probably damaging	1.00
R0043:Dnah1	UTSW	14	31274405	missense	probably damaging	0.97
R0092:Dnah1	UTSW	14	31271609	missense	probably benign	0.00
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0101:Dnah1	UTSW	14	31283899	missense	probably damaging	1.00
R0119:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0136:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0144:Dnah1	UTSW	14	31267874	splice site	probably benign
R0279:Dnah1	UTSW	14	31302375	missense	possibly damaging	0.94
R0299:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0316:Dnah1	UTSW	14	31278151	missense	probably benign	0.00
R0739:Dnah1	UTSW	14	31265915	nonsense	probably null
R0789:Dnah1	UTSW	14	31304591	missense	probably benign
R0826:Dnah1	UTSW	14	31303907	missense	probably benign	0.02
R1102:Dnah1	UTSW	14	31296457	nonsense	probably null
R1229:Dnah1	UTSW	14	31310851	missense	probably benign	0.11
R1447:Dnah1	UTSW	14	31306898	missense	probably benign	0.06
R1449:Dnah1	UTSW	14	31263951	missense	probably damaging	1.00
R1462:Dnah1	UTSW	14	31268781	splice site	probably benign
R1482:Dnah1	UTSW	14	31294874	missense	probably damaging	1.00
R1500:Dnah1	UTSW	14	31316758	missense	probably benign
R1512:Dnah1	UTSW	14	31293037	missense	probably damaging	1.00
R1591:Dnah1	UTSW	14	31272332	missense	probably benign	0.01
R1598:Dnah1	UTSW	14	31301262	missense	probably benign	0.07
R1644:Dnah1	UTSW	14	31302292	splice site	probably benign
R1672:Dnah1	UTSW	14	31276200	missense	probably damaging	1.00
R1713:Dnah1	UTSW	14	31279182	missense	probably damaging	1.00
R1769:Dnah1	UTSW	14	31310882	missense	probably null	0.05
R1796:Dnah1	UTSW	14	31261093	missense	probably benign	0.00
R1902:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1903:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1905:Dnah1	UTSW	14	31264630	missense	probably benign	0.06
R1908:Dnah1	UTSW	14	31262558	missense	probably damaging	1.00
R1972:Dnah1	UTSW	14	31265391	nonsense	probably null
R1973:Dnah1	UTSW	14	31265391	nonsense	probably null
R2004:Dnah1	UTSW	14	31301856	missense	possibly damaging	0.79
R2051:Dnah1	UTSW	14	31279123	missense	probably damaging	1.00
R2062:Dnah1	UTSW	14	31271129	missense	probably damaging	1.00
R2188:Dnah1	UTSW	14	31279164	missense	probably damaging	0.98
R2240:Dnah1	UTSW	14	31299974	missense	probably benign	0.00
R2862:Dnah1	UTSW	14	31284762	missense	probably benign	0.21
R2894:Dnah1	UTSW	14	31298761	missense	possibly damaging	0.67
R3120:Dnah1	UTSW	14	31266822	nonsense	probably null
R3410:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3411:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3435:Dnah1	UTSW	14	31316674	missense	probably damaging	0.96
R3615:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3616:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3741:Dnah1	UTSW	14	31265467	splice site	probably benign
R3805:Dnah1	UTSW	14	31294763	missense	possibly damaging	0.67
R3894:Dnah1	UTSW	14	31307028	missense	probably benign
R4007:Dnah1	UTSW	14	31303784	splice site	probably benign
R4201:Dnah1	UTSW	14	31262270	missense	probably benign	0.00
R4232:Dnah1	UTSW	14	31304916	missense	probably benign
R4372:Dnah1	UTSW	14	31304922	missense	probably damaging	1.00
R4391:Dnah1	UTSW	14	31294835	missense	probably damaging	1.00
R4423:Dnah1	UTSW	14	31284761	missense	probably benign	0.00
R4526:Dnah1	UTSW	14	31285998	missense	probably benign	0.05
R4650:Dnah1	UTSW	14	31284887	splice site	probably null
R4723:Dnah1	UTSW	14	31272942	missense	probably damaging	1.00
R4748:Dnah1	UTSW	14	31319945	missense	probably benign
R4783:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4784:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4785:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4843:Dnah1	UTSW	14	31264963	missense	probably damaging	1.00
R4879:Dnah1	UTSW	14	31300748	missense	possibly damaging	0.91
R4897:Dnah1	UTSW	14	31267539	missense	probably damaging	1.00
R4911:Dnah1	UTSW	14	31295323	missense	probably damaging	1.00
R4985:Dnah1	UTSW	14	31286898	missense	probably null	1.00
R5070:Dnah1	UTSW	14	31282418	missense	probably benign	0.05
R5128:Dnah1	UTSW	14	31296195	splice site	probably null
R5409:Dnah1	UTSW	14	31263255	missense	probably damaging	1.00
R5436:Dnah1	UTSW	14	31316747	missense	probably benign
R5481:Dnah1	UTSW	14	31308871	missense	possibly damaging	0.55
R5550:Dnah1	UTSW	14	31316708	missense	probably benign	0.00
R5555:Dnah1	UTSW	14	31290819	missense	probably damaging	0.99
R5566:Dnah1	UTSW	14	31274366	missense	probably benign	0.35
R5623:Dnah1	UTSW	14	31286023	missense	possibly damaging	0.62
R5701:Dnah1	UTSW	14	31274044	missense	probably damaging	1.00
R5751:Dnah1	UTSW	14	31310906	missense	probably benign	0.00
R5823:Dnah1	UTSW	14	31266418	missense	possibly damaging	0.92
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6090:Dnah1	UTSW	14	31269425	missense	possibly damaging	0.83
R6139:Dnah1	UTSW	14	31286027	missense	probably benign	0.02
R6145:Dnah1	UTSW	14	31300970	missense	probably benign	0.07
R6306:Dnah1	UTSW	14	31304587	missense	probably damaging	0.97
R6376:Dnah1	UTSW	14	31275608	missense	probably damaging	1.00
R6451:Dnah1	UTSW	14	31300808	missense	probably benign	0.08
R6549:Dnah1	UTSW	14	31269383	missense	probably damaging	1.00
R6748:Dnah1	UTSW	14	31299988	missense	probably damaging	0.99
R6826:Dnah1	UTSW	14	31286290	missense	probably benign	0.00
R6870:Dnah1	UTSW	14	31271061	nonsense	probably null
R6932:Dnah1	UTSW	14	31287776	missense	probably damaging	1.00
R6944:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R7033:Dnah1	UTSW	14	31264925	missense	probably damaging	1.00
R7078:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R7133:Dnah1	UTSW	14	31286076	missense	probably benign
R7136:Dnah1	UTSW	14	31298656	missense	probably damaging	1.00
R7203:Dnah1	UTSW	14	31274382	missense	probably benign
R7241:Dnah1	UTSW	14	31264939	missense	probably benign	0.00
R7260:Dnah1	UTSW	14	31269386	missense	probably damaging	1.00
R7264:Dnah1	UTSW	14	31269894	missense	probably benign
R7291:Dnah1	UTSW	14	31298705	missense	probably damaging	1.00
R7293:Dnah1	UTSW	14	31287863	missense	probably damaging	1.00
R7300:Dnah1	UTSW	14	31269841	missense	probably benign	0.05
R7319:Dnah1	UTSW	14	31296594	missense	probably benign	0.02
R7323:Dnah1	UTSW	14	31298707	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31261590	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31300791	missense	possibly damaging	0.80
R7499:Dnah1	UTSW	14	31315122	nonsense	probably null
R7526:Dnah1	UTSW	14	31287876	missense	possibly damaging	0.49
R7560:Dnah1	UTSW	14	31304983	missense	probably benign
R7574:Dnah1	UTSW	14	31319908	missense	probably benign	0.00
R7617:Dnah1	UTSW	14	31284782	missense	possibly damaging	0.80
R7620:Dnah1	UTSW	14	31303906	missense	possibly damaging	0.47
R7692:Dnah1	UTSW	14	31292338	missense	probably benign	0.00
R7702:Dnah1	UTSW	14	31310909	missense	probably benign
R7786:Dnah1	UTSW	14	31262521	missense	probably damaging	1.00
R7984:Dnah1	UTSW	14	31267815	missense	probably damaging	1.00
R8002:Dnah1	UTSW	14	31298722	missense	probably damaging	1.00
R8022:Dnah1	UTSW	14	31265014	missense	probably damaging	1.00
R8032:Dnah1	UTSW	14	31271548	missense	probably damaging	1.00
R8099:Dnah1	UTSW	14	31302364	missense	probably benign	0.00
R8171:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R8263:Dnah1	UTSW	14	31293177	missense	probably damaging	1.00
R8274:Dnah1	UTSW	14	31295574	missense	probably benign	0.00
R8345:Dnah1	UTSW	14	31264594	missense	probably damaging	1.00
R8348:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8353:Dnah1	UTSW	14	31283202	missense	probably benign
R8356:Dnah1	UTSW	14	31273015	missense	probably benign	0.00
R8376:Dnah1	UTSW	14	31301346	missense	probably damaging	1.00
R8448:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8461:Dnah1	UTSW	14	31305958	missense	probably benign	0.00
R8534:Dnah1	UTSW	14	31301848	missense	probably benign	0.16
R8544:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R8679:Dnah1	UTSW	14	31267810	missense	possibly damaging	0.77
R8716:Dnah1	UTSW	14	31267984	critical splice donor site	probably benign
R8750:Dnah1	UTSW	14	31304967	missense	probably benign	0.30
R8790:Dnah1	UTSW	14	31296275	missense	possibly damaging	0.89
R8808:Dnah1	UTSW	14	31286814	missense	probably benign
R8821:Dnah1	UTSW	14	31296498	missense	probably benign
R8887:Dnah1	UTSW	14	31311040	missense	probably damaging	1.00
R8948:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8950:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8955:Dnah1	UTSW	14	31285993	missense	probably benign
R8987:Dnah1	UTSW	14	31311747	missense	possibly damaging	0.93
R8998:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R8999:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R9015:Dnah1	UTSW	14	31264359	missense	probably damaging	0.96
R9031:Dnah1	UTSW	14	31279171	missense	probably benign
R9088:Dnah1	UTSW	14	31266013	missense	probably benign	0.04
R9096:Dnah1	UTSW	14	31261070	missense	probably damaging	0.99
R9117:Dnah1	UTSW	14	31311624	splice site	probably benign
R9157:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9296:Dnah1	UTSW	14	31274054	critical splice acceptor site	probably null
R9313:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9325:Dnah1	UTSW	14	31276203	missense	possibly damaging	0.69
R9352:Dnah1	UTSW	14	31316663	missense	probably benign	0.00
R9411:Dnah1	UTSW	14	31296299	missense	probably damaging	1.00
R9429:Dnah1	UTSW	14	31275542	nonsense	probably null
R9452:Dnah1	UTSW	14	31296491	missense	probably benign	0.35
R9562:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9565:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9616:Dnah1	UTSW	14	31304443	missense	probably null	0.20
R9621:Dnah1	UTSW	14	31294815	missense	probably damaging	1.00
R9677:Dnah1	UTSW	14	31307864	missense	probably benign	0.00
R9723:Dnah1	UTSW	14	31265989	missense	probably damaging	1.00
R9758:Dnah1	UTSW	14	31263438	missense	probably damaging	0.98
RF006:Dnah1	UTSW	14	31307875	missense	probably benign	0.08
Z1088:Dnah1	UTSW	14	31304811	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TTCTCCTTGCCCTGCAAGATGGAC -3'
(R):5'- GACTCTTCTGGGAAGGAAGCTGTTG -3'

Sequencing Primer
(F):5'- TCAGCCTTGAAGTCCGTG -3'
(R):5'- GTGTTTCCTCCATCAGACACTG -3'

Posted On

2014-01-05