Incidental Mutation 'R1116:Mettl17'
ID 97337
Institutional Source Beutler Lab
Gene Symbol Mettl17
Ensembl Gene ENSMUSG00000004561
Gene Name methyltransferase like 17
Synonyms 2310032K15Rik, Mett11d1, D14Ertd209e
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R1116 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 51884842-51893039 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51889598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 281 (V281A)
Ref Sequence ENSEMBL: ENSMUSP00000130200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568] [ENSMUST00000167984] [ENSMUST00000168217]
AlphaFold Q3U2U7
Predicted Effect probably benign
Transcript: ENSMUST00000047726
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
AA Change: V281A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561
AA Change: V281A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163603
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164801
Predicted Effect probably benign
Transcript: ENSMUST00000164902
AA Change: V281A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561
AA Change: V281A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165150
Predicted Effect probably benign
Transcript: ENSMUST00000165568
AA Change: V228A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561
AA Change: V228A

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168409
Predicted Effect probably benign
Transcript: ENSMUST00000167984
Predicted Effect probably benign
Transcript: ENSMUST00000168217
SMART Domains Protein: ENSMUSP00000130565
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Meta Mutation Damage Score 0.4789 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Mettl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mettl17 APN 14 51888835 missense probably damaging 1.00
IGL00915:Mettl17 APN 14 51887289 missense probably benign 0.00
IGL02111:Mettl17 APN 14 51891386 missense probably damaging 1.00
IGL02573:Mettl17 APN 14 51888047 critical splice donor site probably null
R1075:Mettl17 UTSW 14 51889606 missense probably benign 0.18
R1481:Mettl17 UTSW 14 51890703 missense probably benign
R1690:Mettl17 UTSW 14 51891461 missense probably damaging 1.00
R1786:Mettl17 UTSW 14 51888735 splice site probably benign
R1956:Mettl17 UTSW 14 51888797 missense probably damaging 1.00
R4419:Mettl17 UTSW 14 51887272 missense possibly damaging 0.66
R4602:Mettl17 UTSW 14 51888789 missense probably damaging 1.00
R4831:Mettl17 UTSW 14 51884983 missense probably benign 0.38
R6017:Mettl17 UTSW 14 51891617 unclassified probably benign
R6171:Mettl17 UTSW 14 51888779 missense probably damaging 1.00
R8035:Mettl17 UTSW 14 51891490 missense probably damaging 1.00
R8543:Mettl17 UTSW 14 51888800 missense probably benign 0.36
R8726:Mettl17 UTSW 14 51890730 critical splice donor site probably null
R8739:Mettl17 UTSW 14 51891391 missense possibly damaging 0.89
R8865:Mettl17 UTSW 14 51884851 unclassified probably benign
R9408:Mettl17 UTSW 14 51888034 missense probably damaging 1.00
R9497:Mettl17 UTSW 14 51891572 missense unknown
R9559:Mettl17 UTSW 14 51891552 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAATGTGGCACACAAGACAGCAATG -3'
(R):5'- TGGATACCCTAAGGAAGCACCCAG -3'

Sequencing Primer
(F):5'- acacctgtaatctcagcactc -3'
(R):5'- GGAAGCACCCAGACATCTATAAAGG -3'
Posted On 2014-01-05