Incidental Mutation 'R1116:Pck2'
Institutional Source Beutler Lab
Gene Symbol Pck2
Ensembl Gene ENSMUSG00000040618
Gene Namephosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms1810010O14Rik, 9130022B02Rik
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosomal Location55540266-55551242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55545366 bp
Amino Acid Change Aspartic acid to Glycine at position 392 (D392G)
Ref Sequence ENSEMBL: ENSMUSP00000153733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048781] [ENSMUST00000226352] [ENSMUST00000226519] [ENSMUST00000228240]
Predicted Effect probably benign
Transcript: ENSMUST00000048781
AA Change: D419G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038555
Gene: ENSMUSG00000040618
AA Change: D419G

low complexity region 2 22 N/A INTRINSIC
Pfam:PEPCK 73 664 1.9e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226295
Predicted Effect probably benign
Transcript: ENSMUST00000226352
AA Change: D392G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226514
Predicted Effect probably benign
Transcript: ENSMUST00000226519
AA Change: D392G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect unknown
Transcript: ENSMUST00000226650
AA Change: D382G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226770
Predicted Effect probably benign
Transcript: ENSMUST00000228240
AA Change: D384G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228843
Predicted Effect probably benign
Transcript: ENSMUST00000228921
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Micu2 A T 14: 57,954,200 D131E probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Pck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pck2 APN 14 55542641 missense probably benign 0.30
IGL00430:Pck2 APN 14 55543944 missense probably benign 0.07
IGL00814:Pck2 APN 14 55548299 unclassified probably benign
IGL01012:Pck2 APN 14 55544069 splice site probably benign
IGL02095:Pck2 APN 14 55542510 missense probably benign 0.02
IGL02227:Pck2 APN 14 55543866 missense probably benign
IGL02435:Pck2 APN 14 55544390 splice site probably benign
IGL03124:Pck2 APN 14 55545333 missense probably damaging 1.00
R0271:Pck2 UTSW 14 55544584 critical splice donor site probably null
R1014:Pck2 UTSW 14 55542410 missense probably benign 0.00
R1640:Pck2 UTSW 14 55548584 missense possibly damaging 0.51
R1793:Pck2 UTSW 14 55543965 missense possibly damaging 0.81
R1965:Pck2 UTSW 14 55542507 missense probably benign 0.07
R1983:Pck2 UTSW 14 55544068 splice site probably null
R3196:Pck2 UTSW 14 55543992 missense probably damaging 1.00
R4751:Pck2 UTSW 14 55542561 missense probably damaging 1.00
R5385:Pck2 UTSW 14 55545231 missense probably damaging 1.00
R5960:Pck2 UTSW 14 55548547 missense possibly damaging 0.48
R6134:Pck2 UTSW 14 55543962 missense probably damaging 1.00
R6276:Pck2 UTSW 14 55542624 missense probably damaging 1.00
R7030:Pck2 UTSW 14 55547766 missense probably damaging 1.00
R7199:Pck2 UTSW 14 55548712 missense probably benign 0.43
R7516:Pck2 UTSW 14 55542456 missense probably benign 0.00
R8066:Pck2 UTSW 14 55544401 missense probably benign 0.30
X0065:Pck2 UTSW 14 55548063 missense probably benign 0.01
Z1176:Pck2 UTSW 14 55545269 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctcacaaccgtctgtaattc -3'
Posted On2014-01-05