Incidental Mutation 'R1116:Micu2'
ID97341
Institutional Source Beutler Lab
Gene Symbol Micu2
Ensembl Gene ENSMUSG00000021973
Gene Namemitochondrial calcium uptake 2
Synonyms4833427E09Rik, 1110008L20Rik, Efha1
MMRRC Submission 039189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1116 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57916261-57999262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57954200 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 131 (D131E)
Ref Sequence ENSEMBL: ENSMUSP00000022543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022543]
Predicted Effect probably benign
Transcript: ENSMUST00000022543
AA Change: D131E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022543
Gene: ENSMUSG00000021973
AA Change: D131E

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
EFh 173 201 1.15e0 SMART
EFh 363 391 1.12e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225116
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enlarged heart left atrium along with delayed calcium reuptake and decreased relaxation rates by cardiomyocytes, and develop abdominal aortic aneurysms with spontaneous rupture following angiotensin II treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik A T 10: 3,120,180 noncoding transcript Het
Abi3bp T C 16: 56,686,429 probably benign Het
Acacb C T 5: 114,210,956 P1028S probably damaging Het
Acad10 A G 5: 121,630,751 F717S probably damaging Het
Adgrg6 A T 10: 14,438,428 Y705N probably benign Het
Adm A G 7: 110,628,294 I6V probably benign Het
Agps T G 2: 75,861,925 probably benign Het
Atr C T 9: 95,867,636 Q501* probably null Het
Cacna2d3 A G 14: 29,064,321 probably benign Het
Ccnt1 G A 15: 98,544,338 R350W probably damaging Het
Cfap74 G A 4: 155,433,996 E564K probably benign Het
Clip1 T C 5: 123,579,491 E1250G probably damaging Het
Cryz A C 3: 154,621,603 probably benign Het
Dnah1 C A 14: 31,307,867 V494F probably benign Het
Dpep3 G T 8: 105,978,829 D96E probably damaging Het
Dyrk3 G A 1: 131,129,182 A418V probably damaging Het
Ehf T A 2: 103,267,009 N231I probably damaging Het
Eif4g3 T C 4: 138,091,775 probably null Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam178b A T 1: 36,578,588 C82* probably null Het
Gm1647 C T 3: 69,156,872 Q31* probably null Het
Got1 T A 19: 43,502,974 K346* probably null Het
Grid2ip G A 5: 143,382,914 G656D possibly damaging Het
Grm2 A G 9: 106,647,927 Y530H probably damaging Het
Hyou1 T C 9: 44,384,681 I381T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
March11 T C 15: 26,409,295 L360P probably damaging Het
Mettl17 T C 14: 51,889,598 V281A probably benign Het
Mug1 G C 6: 121,870,645 V661L probably benign Het
Myo18b A T 5: 112,803,279 D1488E probably damaging Het
Nkg7 G A 7: 43,437,454 V51I probably benign Het
Nlgn1 A C 3: 25,433,874 S766A probably benign Het
Olfr462 T A 11: 87,889,408 M163L probably benign Het
Otog T C 7: 46,300,601 probably benign Het
Pax2 T C 19: 44,757,424 S11P probably damaging Het
Pck2 A G 14: 55,545,366 D392G probably benign Het
Plxnd1 A T 6: 115,967,005 probably null Het
Prkdc A G 16: 15,783,079 D2868G probably benign Het
Prl3d2 T C 13: 27,126,002 L149P probably damaging Het
Purg A T 8: 33,386,745 H137L probably benign Het
Slc38a8 A T 8: 119,496,133 L150Q probably damaging Het
Tifab T A 13: 56,176,212 R139S possibly damaging Het
Txndc16 T C 14: 45,162,985 H353R probably benign Het
Upk2 A G 9: 44,453,789 probably null Het
Zdhhc25 G A 15: 88,600,620 V53I probably benign Het
Zfp738 T A 13: 67,670,243 probably null Het
Zfp810 C T 9: 22,279,085 E176K probably benign Het
Zfp846 T A 9: 20,593,263 W140R possibly damaging Het
Other mutations in Micu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Micu2 APN 14 57943625 missense probably damaging 1.00
IGL02416:Micu2 APN 14 57923965 missense probably damaging 0.99
IGL02675:Micu2 APN 14 57945377 splice site probably benign
IGL03343:Micu2 APN 14 57917311 missense probably benign 0.01
ANU22:Micu2 UTSW 14 57943625 missense probably damaging 1.00
R0238:Micu2 UTSW 14 57917378 splice site probably benign
R0239:Micu2 UTSW 14 57917378 splice site probably benign
R0488:Micu2 UTSW 14 57932242 missense probably benign 0.00
R0564:Micu2 UTSW 14 57919374 missense possibly damaging 0.82
R1471:Micu2 UTSW 14 57945397 missense probably damaging 0.99
R2011:Micu2 UTSW 14 57954133 splice site probably null
R4226:Micu2 UTSW 14 57932285 missense possibly damaging 0.92
R5595:Micu2 UTSW 14 57971744 missense probably damaging 1.00
R6583:Micu2 UTSW 14 57943670 missense probably damaging 0.99
R6800:Micu2 UTSW 14 57919439 missense possibly damaging 0.89
R7125:Micu2 UTSW 14 57971781 nonsense probably null
R7205:Micu2 UTSW 14 57954149 missense probably benign 0.42
R7383:Micu2 UTSW 14 57917353 missense possibly damaging 0.63
R7852:Micu2 UTSW 14 57932253 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAACTCCTCACTTCACACGTT -3'
(R):5'- TGGCTTCCCCAAGCCTCCAG -3'

Sequencing Primer
(F):5'- GAAACACCTATTGTATCACATGGC -3'
(R):5'- ccccccctacctcaacc -3'
Posted On2014-01-05