Incidental Mutation 'R0988:Olfr341'
ID97344
Institutional Source Beutler Lab
Gene Symbol Olfr341
Ensembl Gene ENSMUSG00000075387
Gene Nameolfactory receptor 341
SynonymsGA_x6K02T2NLDC-33174915-33173974, MOR136-2
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36473721-36482468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36479767 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000150801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100154] [ENSMUST00000213300]
Predicted Effect probably damaging
Transcript: ENSMUST00000100154
AA Change: D121G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097731
Gene: ENSMUSG00000075387
AA Change: D121G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4e-6 PFAM
Pfam:7tm_1 41 290 9.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213300
AA Change: D121G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Olfr341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Olfr341 APN 2 36479356 missense probably damaging 1.00
IGL01469:Olfr341 APN 2 36479824 missense probably benign 0.44
IGL02269:Olfr341 APN 2 36479567 missense possibly damaging 0.86
IGL02870:Olfr341 APN 2 36480031 missense probably benign
IGL03190:Olfr341 APN 2 36479722 missense probably damaging 1.00
R1214:Olfr341 UTSW 2 36479969 missense possibly damaging 0.67
R1785:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R1786:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2130:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2131:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2132:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2133:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2568:Olfr341 UTSW 2 36479974 missense probably damaging 1.00
R4115:Olfr341 UTSW 2 36479785 missense probably damaging 1.00
R4384:Olfr341 UTSW 2 36479998 missense probably damaging 1.00
R4721:Olfr341 UTSW 2 36479824 missense probably benign 0.44
R5375:Olfr341 UTSW 2 36479297 missense probably damaging 0.98
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6084:Olfr341 UTSW 2 36479512 missense probably benign 0.01
R6340:Olfr341 UTSW 2 36480020 missense probably benign 0.31
R7238:Olfr341 UTSW 2 36479714 missense possibly damaging 0.54
R7532:Olfr341 UTSW 2 36480126 start codon destroyed probably null 0.27
R7830:Olfr341 UTSW 2 36479380 missense probably damaging 1.00
R7910:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
R7991:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCAATAAGGCAGAGGGTTCACAG -3'
(R):5'- TCCCCATTCAGCCAGAGGATCAAG -3'

Sequencing Primer
(F):5'- TTCACAGAAGTAGTGGGGAATG -3'
(R):5'- ATGTACCTGACAACTGTGCTG -3'
Posted On2014-01-05