Incidental Mutation 'R0988:Cst11'
ID97350
Institutional Source Beutler Lab
Gene Symbol Cst11
Ensembl Gene ENSMUSG00000036958
Gene Namecystatin 11
SynonymsmCST E1, 9230101F08Rik, CRES2, cystatin E1
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148768609-148771497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148770426 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 97 (T97I)
Ref Sequence ENSEMBL: ENSMUSP00000028934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028934]
Predicted Effect probably benign
Transcript: ENSMUST00000028934
AA Change: T97I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028934
Gene: ENSMUSG00000036958
AA Change: T97I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 32 136 2.24e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein shown to have antimicrobial activity against E. coli. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Cst11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Cst11 APN 2 148771241 missense probably damaging 1.00
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0060:Cst11 UTSW 2 148770402 missense probably damaging 1.00
R2102:Cst11 UTSW 2 148771240 missense probably damaging 1.00
R4042:Cst11 UTSW 2 148771280 missense probably benign 0.00
R5008:Cst11 UTSW 2 148770405 missense probably benign 0.24
R5768:Cst11 UTSW 2 148770467 nonsense probably null
R7140:Cst11 UTSW 2 148768729 missense probably benign 0.36
R7841:Cst11 UTSW 2 148771307 missense possibly damaging 0.93
X0024:Cst11 UTSW 2 148770460 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGGACCCACTCTGACTATGCTCAC -3'
(R):5'- AGAAGCAAGGTGTAAAGCTGTCCTG -3'

Sequencing Primer
(F):5'- ACTATGCTCACAGATGTGGC -3'
(R):5'- GTAAAGCTGTCCTGCCCATATAG -3'
Posted On2014-01-05