Mutagenetix > Incidental Mutations

Incidental Mutation 'R1117:Crispld1'

97368

Institutional Source

Beutler Lab

Gene Symbol

Crispld1

Ensembl Gene

ENSMUSG00000025776

Gene Name

cysteine-rich secretory protein LCCL domain containing 1

Synonyms

Cocoacrisp

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17727045-17766344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 17749622 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 281 (N281K)

Ref Sequence

ENSEMBL: ENSMUSP00000124095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958] [ENSMUST00000160305]

Predicted Effect

probably benign
Transcript: ENSMUST00000095075
AA Change: N281K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: N281K

Domain	Start	End	E-Value	Type
SCP	60	214	1.63e-41	SMART
LCCL	291	375	1.6e-52	SMART
LCCL	392	483	1.55e-59	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159958
AA Change: N281K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: N281K

Domain	Start	End	E-Value	Type
SCP	60	214	1.63e-41	SMART
LCCL	291	375	1.6e-52	SMART
LCCL	392	483	1.55e-59	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160305

SMART Domains

Protein: ENSMUSP00000123800
Gene: ENSMUSG00000025776

Domain	Start	End	E-Value	Type
SCP	60	162	1.26e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189853

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Crispld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Crispld1	APN	1	17746801	missense	probably benign	0.21
IGL01610:Crispld1	APN	1	17746725	splice site	probably null
IGL01991:Crispld1	APN	1	17753017	missense	probably benign
IGL02004:Crispld1	APN	1	17747520	missense	probably damaging	1.00
IGL02178:Crispld1	APN	1	17762103	splice site	probably benign
IGL02200:Crispld1	APN	1	17750333	unclassified	probably benign
IGL02251:Crispld1	APN	1	17728840	missense	probably benign	0.06
IGL02506:Crispld1	APN	1	17756305	missense	probably damaging	0.99
IGL02883:Crispld1	APN	1	17746789	missense	possibly damaging	0.87
IGL03310:Crispld1	APN	1	17745477	splice site	probably benign
milliliter	UTSW	1	17750801	missense	possibly damaging	0.81
Spoonful	UTSW	1	17762141	missense	probably damaging	1.00
R0068:Crispld1	UTSW	1	17752988	missense	possibly damaging	0.89
R0324:Crispld1	UTSW	1	17749591	missense	probably benign
R0542:Crispld1	UTSW	1	17746768	missense	possibly damaging	0.75
R1157:Crispld1	UTSW	1	17745363	missense	possibly damaging	0.70
R1585:Crispld1	UTSW	1	17750800	missense	possibly damaging	0.68
R1630:Crispld1	UTSW	1	17728798	missense	probably benign
R2081:Crispld1	UTSW	1	17762179	missense	probably damaging	0.99
R2143:Crispld1	UTSW	1	17749636	missense	probably benign
R2472:Crispld1	UTSW	1	17745828	missense	probably null	0.12
R2520:Crispld1	UTSW	1	17750776	missense	probably damaging	1.00
R4476:Crispld1	UTSW	1	17747510	missense	probably damaging	1.00
R4486:Crispld1	UTSW	1	17752878	missense	probably benign	0.01
R4779:Crispld1	UTSW	1	17749607	missense	probably benign
R5508:Crispld1	UTSW	1	17752983	missense	probably damaging	1.00
R5568:Crispld1	UTSW	1	17750271	missense	probably benign	0.01
R6155:Crispld1	UTSW	1	17753017	missense	probably benign
R6252:Crispld1	UTSW	1	17749507	missense	probably benign	0.00
R6361:Crispld1	UTSW	1	17762231	missense	probably damaging	0.99
R6617:Crispld1	UTSW	1	17728662	missense	probably benign	0.02
R6760:Crispld1	UTSW	1	17750801	missense	possibly damaging	0.81
R6961:Crispld1	UTSW	1	17762141	missense	probably damaging	1.00
R7278:Crispld1	UTSW	1	17752878	missense	probably benign	0.01
R7403:Crispld1	UTSW	1	17747596	missense	probably damaging	1.00
R7592:Crispld1	UTSW	1	17728766	missense	possibly damaging	0.64
R7837:Crispld1	UTSW	1	17728730	missense	probably benign	0.42
R7920:Crispld1	UTSW	1	17728730	missense	probably benign	0.42
Z1088:Crispld1	UTSW	1	17764076	missense	probably benign
Z1176:Crispld1	UTSW	1	17728613	start gained	probably benign
Z1176:Crispld1	UTSW	1	17752851	missense	possibly damaging	0.60
Z1177:Crispld1	UTSW	1	17764092	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACAACCTGTGCTGAAAAGAGTACTGAAT -3'
(R):5'- TGGTCCCTTTACACTGGTCTCTCAA -3'

Sequencing Primer
(F):5'- AGCATTTGTTCAATAGTTTGTGCTC -3'
(R):5'- ttctttctctctttctttctttccc -3'

Posted On

2014-01-05