Incidental Mutation 'R0988:Hpn'
ID97379
Institutional Source Beutler Lab
Gene Symbol Hpn
Ensembl Gene ENSMUSG00000001249
Gene Namehepsin
SynonymsHlb320
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31098725-31115290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31099898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 271 (Y271C)
Ref Sequence ENSEMBL: ENSMUSP00000131658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039435] [ENSMUST00000108102] [ENSMUST00000165124] [ENSMUST00000168884] [ENSMUST00000171259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039435
AA Change: Y300C

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038149
Gene: ENSMUSG00000001249
AA Change: Y300C

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
SR 82 179 8.44e-5 SMART
Tryp_SPc 190 428 3.09e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108102
AA Change: Y291C

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103737
Gene: ENSMUSG00000001249
AA Change: Y291C

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
SR 73 170 8.44e-5 SMART
Tryp_SPc 181 419 3.09e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164340
Predicted Effect probably benign
Transcript: ENSMUST00000165124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167719
Predicted Effect possibly damaging
Transcript: ENSMUST00000168884
AA Change: Y271C

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131658
Gene: ENSMUSG00000001249
AA Change: Y271C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 53 150 8.44e-5 SMART
Tryp_SPc 161 399 3.09e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171225
Predicted Effect probably benign
Transcript: ENSMUST00000171259
AA Change: Y14C

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132307
Gene: ENSMUSG00000001249
AA Change: Y14C

DomainStartEndE-ValueType
Tryp_SPc 1 142 5.41e-30 SMART
Meta Mutation Damage Score 0.1699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: This gene encodes a type II transmembrane serine protease that may function in diverse processes, including regulation of cell growth. Deficiency in this gene results in hearing loss. The protein is cleaved into a catalytic serine protease chain and a non-catalytic scavenger receptor cysteine-rich chain, which associate via a single disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation are hypothyroidic and develop profound hearing loss associated with structural changes in the tectorial membrane and a myelination defect affecting the compaction of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Hpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Hpn APN 7 31103513 missense possibly damaging 0.51
sweetsoup UTSW 7 31099898 missense possibly damaging 0.76
R0238:Hpn UTSW 7 31099390 splice site probably benign
R0671:Hpn UTSW 7 31109160 missense possibly damaging 0.66
R0747:Hpn UTSW 7 31099546 missense probably damaging 1.00
R0864:Hpn UTSW 7 31109001 missense probably benign
R1892:Hpn UTSW 7 31099043 nonsense probably null
R1893:Hpn UTSW 7 31099348 missense probably damaging 1.00
R4829:Hpn UTSW 7 31098875 utr 3 prime probably benign
R5152:Hpn UTSW 7 31099836 missense probably damaging 0.99
R5338:Hpn UTSW 7 31103356 missense probably benign 0.20
R5664:Hpn UTSW 7 31099262 missense probably damaging 1.00
R7003:Hpn UTSW 7 31110942 intron probably benign
R8235:Hpn UTSW 7 31102783 missense possibly damaging 0.85
X0019:Hpn UTSW 7 31099035 makesense probably null
Predicted Primers PCR Primer
(F):5'- TAGCCTGTTGGCCTAAGGGGAC -3'
(R):5'- GGGCTGGAGAAAGCCTCATGAC -3'

Sequencing Primer
(F):5'- GGAAACAAGCCCTTTCTCCTG -3'
(R):5'- gaaactttggacagaagacatgg -3'
Posted On2014-01-05