Incidental Mutation 'R1117:Fmo4'
ID 97380
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Name flavin containing monooxygenase 4
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 162793188-162813972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 162803663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
AlphaFold Q8VHG0
Predicted Effect probably benign
Transcript: ENSMUST00000028014
AA Change: V245A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: V245A

Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111525
AA Change: V245A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: V245A

Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably benign
Transcript: ENSMUST00000140274
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692

Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
R8706:Fmo4 UTSW 1 162794023 nonsense probably null
R9050:Fmo4 UTSW 1 162807530 missense probably benign 0.15
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccccaaataaacaaggtagag -3'
Posted On 2014-01-05