Incidental Mutation 'R0988:Olfr609'
ID97381
Institutional Source Beutler Lab
Gene Symbol Olfr609
Ensembl Gene ENSMUSG00000046396
Gene Nameolfactory receptor 609
SynonymsMOR9-1, GA_x6K02T2PBJ9-6207735-6206776
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103490025-103498062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103492747 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 44 (I44F)
Ref Sequence ENSEMBL: ENSMUSP00000149804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055787] [ENSMUST00000216075] [ENSMUST00000216360]
Predicted Effect probably damaging
Transcript: ENSMUST00000055787
AA Change: I44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051749
Gene: ENSMUSG00000046396
AA Change: I44F

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 1.4e-119 PFAM
Pfam:7TM_GPCR_Srsx 34 169 2.2e-10 PFAM
Pfam:7tm_1 40 291 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216075
AA Change: I44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216360
AA Change: I44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Olfr609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02213:Olfr609 APN 7 103492488 missense probably benign 0.05
IGL02309:Olfr609 APN 7 103491999 missense probably damaging 0.99
R0782:Olfr609 UTSW 7 103492515 missense probably damaging 0.99
R4013:Olfr609 UTSW 7 103492633 missense probably benign
R4600:Olfr609 UTSW 7 103492581 missense probably damaging 0.99
R4735:Olfr609 UTSW 7 103492060 missense possibly damaging 0.61
R4941:Olfr609 UTSW 7 103492251 missense probably damaging 1.00
R5204:Olfr609 UTSW 7 103492540 missense probably damaging 1.00
R5281:Olfr609 UTSW 7 103491973 missense probably benign 0.00
R5941:Olfr609 UTSW 7 103492720 missense possibly damaging 0.95
R6319:Olfr609 UTSW 7 103492725 missense possibly damaging 0.84
R6505:Olfr609 UTSW 7 103492651 missense probably damaging 1.00
R7258:Olfr609 UTSW 7 103492589 missense probably damaging 1.00
X0065:Olfr609 UTSW 7 103491918 makesense probably null
Z1177:Olfr609 UTSW 7 103492610 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGACCAATGCTTCGCACCAAAATG -3'
(R):5'- AGCCGTCTACTACAGTCACCATGTC -3'

Sequencing Primer
(F):5'- AGCACAGATGACTCCATGATG -3'
(R):5'- ACTACAGTCACCATGTCCTACTC -3'
Posted On2014-01-05