Incidental Mutation 'R1117:Slc19a2'
ID97382
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1117 (G1)
Quality Score219
Status Not validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164263456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 278 (I278F)
Ref Sequence ENSEMBL: ENSMUSP00000131327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably benign
Transcript: ENSMUST00000044021
AA Change: I479F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: I479F

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159230
AA Change: I441F

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: I441F

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160773
Predicted Effect possibly damaging
Transcript: ENSMUST00000169394
AA Change: I278F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918
AA Change: I278F

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGTAGTGCAGATGCTCCC -3'
(R):5'- AAAGCTTCCGGCTTCTCTTAGCAG -3'

Sequencing Primer
(F):5'- TGCAGATGCTCCCAGAATG -3'
(R):5'- CTCCAAGACTGCAAGGTGTTAG -3'
Posted On2014-01-05