Incidental Mutation 'R0988:Ntpcr'
ID97389
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 125737431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189]
Predicted Effect probably benign
Transcript: ENSMUST00000034313
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065135
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138656
Predicted Effect probably benign
Transcript: ENSMUST00000143504
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151172
Predicted Effect probably benign
Transcript: ENSMUST00000152189
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R2412:Ntpcr UTSW 8 125745405 missense probably damaging 1.00
R3838:Ntpcr UTSW 8 125737372 missense probably damaging 1.00
R4453:Ntpcr UTSW 8 125736190 missense probably benign 0.14
R6126:Ntpcr UTSW 8 125735887 critical splice donor site probably null
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
R8230:Ntpcr UTSW 8 125737420 critical splice donor site probably null
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGAGTGGTGCTGACATTCAGAGAG -3'
(R):5'- ATGTGACAGCTCAGGGCAACAG -3'

Sequencing Primer
(F):5'- CTGACATTCAGAGAGGGCCTG -3'
(R):5'- CAACAGTCAATTGGACTGCC -3'
Posted On2014-01-05