Incidental Mutation 'R1117:Etnppl'
ID97394
Institutional Source Beutler Lab
Gene Symbol Etnppl
Ensembl Gene ENSMUSG00000019232
Gene Nameethanolamine phosphate phospholyase
Synonyms1300019H02Rik, Agxt2l1
MMRRC Submission 039190-MU
Accession Numbers

Genbank: NM_027907.3, NM_001163587.1; Ensembl: ENSMUST00000072271

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location130617448-130637521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130634563 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 462 (I462M)
Ref Sequence ENSEMBL: ENSMUSP00000131294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072271] [ENSMUST00000163620] [ENSMUST00000166187]
Predicted Effect probably benign
Transcript: ENSMUST00000072271
AA Change: I462M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072121
Gene: ENSMUSG00000019232
AA Change: I462M

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 373 2.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163620
AA Change: I456M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129120
Gene: ENSMUSG00000019232
AA Change: I456M

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 367 1.6e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166187
AA Change: I462M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131294
Gene: ENSMUSG00000019232
AA Change: I462M

DomainStartEndE-ValueType
Pfam:Aminotran_3 26 433 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170664
SMART Domains Protein: ENSMUSP00000128425
Gene: ENSMUSG00000019232

DomainStartEndE-ValueType
Pfam:Aminotran_3 2 120 4.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Etnppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Etnppl APN 3 130631778 missense possibly damaging 0.81
IGL02087:Etnppl APN 3 130626545 missense probably benign
IGL02524:Etnppl APN 3 130630671 unclassified probably benign
IGL03101:Etnppl APN 3 130622318 missense probably damaging 1.00
IGL03120:Etnppl APN 3 130620692 missense probably damaging 1.00
1mM(1):Etnppl UTSW 3 130628830 splice site probably benign
PIT4810001:Etnppl UTSW 3 130620714 missense probably benign 0.35
R0279:Etnppl UTSW 3 130629413 missense probably damaging 1.00
R1075:Etnppl UTSW 3 130629563 missense probably benign 0.01
R1502:Etnppl UTSW 3 130628789 missense probably benign 0.01
R1581:Etnppl UTSW 3 130628744 missense possibly damaging 0.80
R1730:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1783:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1816:Etnppl UTSW 3 130634562 missense probably benign
R1855:Etnppl UTSW 3 130620722 missense probably benign 0.40
R1885:Etnppl UTSW 3 130629462 missense probably benign 0.04
R2330:Etnppl UTSW 3 130630575 missense probably damaging 1.00
R4067:Etnppl UTSW 3 130631793 missense probably damaging 1.00
R5862:Etnppl UTSW 3 130631824 missense possibly damaging 0.89
R6183:Etnppl UTSW 3 130620317 missense probably damaging 1.00
R6374:Etnppl UTSW 3 130620693 missense probably damaging 1.00
R7169:Etnppl UTSW 3 130620696 missense probably damaging 1.00
R7324:Etnppl UTSW 3 130629575 missense probably damaging 1.00
R7654:Etnppl UTSW 3 130629511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGTTGGTCGAGTCATTACACGG -3'
(R):5'- TGAGAAGCAAGGCACCCAGCTTAG -3'

Sequencing Primer
(F):5'- CACGGGTATAAAAGTTTGTCCTGG -3'
(R):5'- AAGGCACCCAGCTTAGTCTTG -3'
Posted On2014-01-05