Incidental Mutation 'R0988:Snrpd3'
ID97401
Institutional Source Beutler Lab
Gene Symbol Snrpd3
Ensembl Gene ENSMUSG00000020180
Gene Namesmall nuclear ribonucleoprotein D3
SynonymsSMD3, 1700043E15Rik, 2310009E13Rik
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75517551-75537381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75532205 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000151655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020397] [ENSMUST00000220229]
Predicted Effect probably benign
Transcript: ENSMUST00000020397
AA Change: D52G

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020397
Gene: ENSMUSG00000020180
AA Change: D52G

DomainStartEndE-ValueType
Sm 8 73 6.21e-17 SMART
low complexity region 110 119 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220229
AA Change: D52G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the spliceosome, which is a nuclear ribonucleoprotein complex that functions in pre-mRNA splicing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Snrpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5072:Snrpd3 UTSW 10 75519393 missense possibly damaging 0.64
R5073:Snrpd3 UTSW 10 75519393 missense possibly damaging 0.64
R5074:Snrpd3 UTSW 10 75519393 missense possibly damaging 0.64
R6019:Snrpd3 UTSW 10 75532195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGTACAGAAAGCTCCAGCC -3'
(R):5'- TCAGATTCACTTGTCCCCATGCAAC -3'

Sequencing Primer
(F):5'- AGCCATTGCTAGGGTAGTTCAC -3'
(R):5'- TTCTAAAGCCAGCCAAGGG -3'
Posted On2014-01-05