Incidental Mutation 'R0988:Olfr807'
Institutional Source Beutler Lab
Gene Symbol Olfr807
Ensembl Gene ENSMUSG00000050478
Gene Nameolfactory receptor 807
SynonymsMOR117-1, GA_x6K02T2PULF-11434134-11433199
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosomal Location129754092-129757793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129754997 bp
Amino Acid Change Valine to Alanine at position 151 (V151A)
Ref Sequence ENSEMBL: ENSMUSP00000150657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059038] [ENSMUST00000213379] [ENSMUST00000217106]
Predicted Effect probably benign
Transcript: ENSMUST00000059038
AA Change: V151A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049924
Gene: ENSMUSG00000050478
AA Change: V151A

Pfam:7tm_4 29 305 3.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 302 3.4e-8 PFAM
Pfam:7tm_1 39 296 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213379
AA Change: V151A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217106
AA Change: V151A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Olfr807
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Olfr807 APN 10 129754655 missense possibly damaging 0.87
IGL03031:Olfr807 APN 10 129755369 missense possibly damaging 0.94
R0691:Olfr807 UTSW 10 129755402 missense probably damaging 1.00
R0848:Olfr807 UTSW 10 129755208 missense probably benign 0.00
R1880:Olfr807 UTSW 10 129755421 missense probably benign 0.09
R1894:Olfr807 UTSW 10 129755074 nonsense probably null
R1935:Olfr807 UTSW 10 129754715 missense probably damaging 1.00
R2513:Olfr807 UTSW 10 129755152 missense probably damaging 1.00
R4201:Olfr807 UTSW 10 129754628 missense probably damaging 1.00
R4643:Olfr807 UTSW 10 129754955 missense probably damaging 1.00
R4651:Olfr807 UTSW 10 129755418 missense probably benign
R4652:Olfr807 UTSW 10 129755418 missense probably benign
R4797:Olfr807 UTSW 10 129754521 missense probably benign 0.06
R5337:Olfr807 UTSW 10 129754534 nonsense probably null
R5597:Olfr807 UTSW 10 129754886 missense probably damaging 1.00
R6310:Olfr807 UTSW 10 129754659 missense probably benign 0.04
R6442:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6443:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6642:Olfr807 UTSW 10 129755363 missense probably damaging 1.00
R7660:Olfr807 UTSW 10 129754563 nonsense probably null
R7862:Olfr807 UTSW 10 129755355 missense probably benign 0.00
Z1088:Olfr807 UTSW 10 129755339 missense possibly damaging 0.77
Z1176:Olfr807 UTSW 10 129754688 missense probably damaging 1.00
Z1176:Olfr807 UTSW 10 129754824 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-05