Incidental Mutation 'R1117:Cpa1'
ID 97410
Institutional Source Beutler Lab
Gene Symbol Cpa1
Ensembl Gene ENSMUSG00000054446
Gene Name carboxypeptidase A1, pancreatic
Synonyms 0910001L12Rik
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 30639218-30645363 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30645261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 412 (D412G)
Ref Sequence ENSEMBL: ENSMUSP00000031806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031806]
AlphaFold Q7TPZ8
Predicted Effect probably benign
Transcript: ENSMUST00000031806
AA Change: D412G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031806
Gene: ENSMUSG00000054446
AA Change: D412G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 1.6e-24 PFAM
Zn_pept 122 402 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139004
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase A, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme. This gene is expressed in pancreas, the encoded protein is a major component of digestive enzymes secreted by pancreas and plays an important role in the process of digestion. This gene is located in a cluster of related carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Cpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cpa1 APN 6 30642969 missense probably benign 0.05
IGL01288:Cpa1 APN 6 30640583 missense probably damaging 1.00
IGL01402:Cpa1 APN 6 30645276 missense possibly damaging 0.83
IGL01504:Cpa1 APN 6 30640721 missense probably benign 0.00
IGL01980:Cpa1 APN 6 30641582 missense possibly damaging 0.78
IGL02885:Cpa1 APN 6 30645170 missense probably damaging 1.00
P0026:Cpa1 UTSW 6 30640906 missense probably damaging 0.96
PIT4544001:Cpa1 UTSW 6 30641858 missense probably benign 0.00
R0398:Cpa1 UTSW 6 30645251 missense probably benign 0.00
R0403:Cpa1 UTSW 6 30641857 missense probably benign 0.15
R1548:Cpa1 UTSW 6 30642335 missense probably damaging 1.00
R1631:Cpa1 UTSW 6 30640924 missense probably damaging 1.00
R1780:Cpa1 UTSW 6 30643008 missense probably damaging 1.00
R2202:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2203:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2204:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2205:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R4838:Cpa1 UTSW 6 30639516 missense possibly damaging 0.80
R5497:Cpa1 UTSW 6 30640730 missense probably benign 0.42
R6306:Cpa1 UTSW 6 30640954 missense probably damaging 1.00
R7062:Cpa1 UTSW 6 30640677 missense probably benign 0.03
R7085:Cpa1 UTSW 6 30643620 missense probably benign 0.10
R7564:Cpa1 UTSW 6 30641768 missense probably damaging 0.97
R8743:Cpa1 UTSW 6 30642993 missense probably damaging 1.00
R8785:Cpa1 UTSW 6 30645252 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGGGAGCACTATTGACTGGACCTAC -3'
(R):5'- CCTCTTAGATGCAGCTTCATGGGAC -3'

Sequencing Primer
(F):5'- TACAGCCAGGGCATCAAGTATTC -3'
(R):5'- tggaatgcaggagaatttaggg -3'
Posted On 2014-01-05