Mutagenetix > Incidental Mutations

Incidental Mutation 'R1117:Mmrn1'

97412

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60976325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 530 (I530K)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129603
AA Change: I530K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: I530K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204333
AA Change: I530K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: I530K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CCTGTGAGAAGCCTGTCAAGGAAC -3'
(R):5'- TCTGCTCCAGCAAAGGCTGAAG -3'

Sequencing Primer
(F):5'- CAAGCTCATTTGGAAGGAGCAC -3'
(R):5'- AGGCTGAAGGATCTCCATGTC -3'

Posted On

2014-01-05