Incidental Mutation 'R1117:Mmrn1'
ID97412
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60976325 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 530 (I530K)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129603
AA Change: I530K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: I530K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204333
AA Change: I530K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: I530K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7915:Mmrn1 UTSW 6 60987060 splice site probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense not run
Z1177:Mmrn1 UTSW 6 60987098 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGTGAGAAGCCTGTCAAGGAAC -3'
(R):5'- TCTGCTCCAGCAAAGGCTGAAG -3'

Sequencing Primer
(F):5'- CAAGCTCATTTGGAAGGAGCAC -3'
(R):5'- AGGCTGAAGGATCTCCATGTC -3'
Posted On2014-01-05