Incidental Mutation 'R1117:Klk1b22'
ID97414
Institutional Source Beutler Lab
Gene Symbol Klk1b22
Ensembl Gene ENSMUSG00000060177
Gene Namekallikrein 1-related peptidase b22
SynonymsKlk22, Egfbp1, mGk-22, Egfbp-1
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44112673-44116922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44116859 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 255 (M255L)
Ref Sequence ENSEMBL: ENSMUSP00000076733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077528]
Predicted Effect probably benign
Transcript: ENSMUST00000077528
AA Change: M255L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000076733
Gene: ENSMUSG00000060177
AA Change: M255L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 251 2.91e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206702
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. The encoded preproprotein undergoes proteolytic processing to generate a functional, mature peptide. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Klk1b22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Klk1b22 APN 7 44116308 missense probably damaging 1.00
IGL02189:Klk1b22 APN 7 44116206 splice site probably null
R1480:Klk1b22 UTSW 7 44116854 missense possibly damaging 0.51
R1581:Klk1b22 UTSW 7 44115975 missense possibly damaging 0.72
R1793:Klk1b22 UTSW 7 44116351 splice site probably benign
R2935:Klk1b22 UTSW 7 44114722 missense probably benign 0.22
R5806:Klk1b22 UTSW 7 44115877 missense possibly damaging 0.90
R7278:Klk1b22 UTSW 7 44114749 missense probably benign 0.01
R7443:Klk1b22 UTSW 7 44116110 missense probably benign
R7646:Klk1b22 UTSW 7 44116118 splice site probably null
R7866:Klk1b22 UTSW 7 44112744 missense possibly damaging 0.76
R7949:Klk1b22 UTSW 7 44112744 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCTCACCTATTGAACAGAGCTGCC -3'
(R):5'- GTCAGCCCTACTTGGAGTCAATCAC -3'

Sequencing Primer
(F):5'- TGTATACTAGAATCCAACTGCCAGG -3'
(R):5'- ACACATATGGCATCCCTGAGTTG -3'
Posted On2014-01-05