Incidental Mutation 'R0988:Lgmn'
ID97415
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102398277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
Predicted Effect probably damaging
Transcript: ENSMUST00000021607
AA Change: D311G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: D311G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110020
AA Change: D311G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: D311G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Meta Mutation Damage Score 0.4618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGGGCTTCTCAACAGGATTCCAG -3'
(R):5'- GGCACACATAGTTTCTCAGCAAACG -3'

Sequencing Primer
(F):5'- TGTTTATACCAGGACGGACAC -3'
(R):5'- acgtgttgaatTTGTATTCTCTCTC -3'
Posted On2014-01-05