Incidental Mutation 'R1117:Umod'
ID 97416
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Name uromodulin
Synonyms uromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
MMRRC Submission 039190-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1117 (G1)
Quality Score 191
Status Not validated
Chromosome 7
Chromosomal Location 119462711-119479282 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119477306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 79 (N79S)
Ref Sequence ENSEMBL: ENSMUSP00000146628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000207261] [ENSMUST00000207460] [ENSMUST00000209095]
AlphaFold Q91X17
Predicted Effect possibly damaging
Transcript: ENSMUST00000033263
AA Change: N79S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: N79S

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207261
AA Change: N79S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000207378
AA Change: N54S

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207460
AA Change: N79S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect possibly damaging
Transcript: ENSMUST00000209095
AA Change: N79S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1073:Umod UTSW 7 119464741 missense possibly damaging 0.56
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R2354:Umod UTSW 7 119466193 missense probably damaging 1.00
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R4446:Umod UTSW 7 119466056 splice site probably null
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7111:Umod UTSW 7 119477146 nonsense probably null
R7168:Umod UTSW 7 119478326 splice site probably benign
R7265:Umod UTSW 7 119466073 missense probably benign 0.00
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
R8749:Umod UTSW 7 119471416 missense probably benign 0.00
R8786:Umod UTSW 7 119477358 missense possibly damaging 0.76
R8939:Umod UTSW 7 119469477 missense probably damaging 1.00
R9320:Umod UTSW 7 119466132 missense probably damaging 1.00
R9689:Umod UTSW 7 119477294 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACACGCACAAGTAGTCGCCTTC -3'
(R):5'- TGAAAATGGGTTCCAGCGGCAG -3'

Sequencing Primer
(F):5'- CAAGTAGTCGCCTTCTGTGTTG -3'
(R):5'- GAGGATTCGCTAAACTCTAGACTG -3'
Posted On 2014-01-05