Incidental Mutation 'R1117:Olfr981'
ID 97420
Institutional Source Beutler Lab
Gene Symbol Olfr981
Ensembl Gene ENSMUSG00000046678
Gene Name olfactory receptor 981
Synonyms MOR223-8, GA_x6K02T2PVTD-33720892-33721824
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 40021464-40030377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40022762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 123 (F123S)
Ref Sequence ENSEMBL: ENSMUSP00000149436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059859] [ENSMUST00000215956]
AlphaFold Q8VEU2
Predicted Effect probably damaging
Transcript: ENSMUST00000059859
AA Change: F123S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057952
Gene: ENSMUSG00000046678
AA Change: F123S

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.4e-54 PFAM
Pfam:7tm_1 41 288 8.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215956
AA Change: F123S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220338
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Olfr981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr981 APN 9 40023278 missense possibly damaging 0.61
IGL02089:Olfr981 APN 9 40022770 missense probably damaging 1.00
R0722:Olfr981 UTSW 9 40022999 missense probably damaging 1.00
R1781:Olfr981 UTSW 9 40023245 missense probably damaging 1.00
R1874:Olfr981 UTSW 9 40022855 missense possibly damaging 0.86
R1893:Olfr981 UTSW 9 40022974 missense possibly damaging 0.64
R1942:Olfr981 UTSW 9 40022735 missense probably damaging 1.00
R1942:Olfr981 UTSW 9 40022752 missense probably damaging 1.00
R1999:Olfr981 UTSW 9 40022689 missense probably benign
R2000:Olfr981 UTSW 9 40022689 missense probably benign
R2173:Olfr981 UTSW 9 40023254 missense probably damaging 0.97
R2760:Olfr981 UTSW 9 40022396 start codon destroyed probably null 0.00
R4300:Olfr981 UTSW 9 40023139 missense probably benign 0.02
R4530:Olfr981 UTSW 9 40023293 missense probably benign
R4614:Olfr981 UTSW 9 40022959 missense probably damaging 1.00
R4661:Olfr981 UTSW 9 40022527 missense probably damaging 1.00
R4777:Olfr981 UTSW 9 40022698 missense possibly damaging 0.90
R5017:Olfr981 UTSW 9 40022376 start gained probably benign
R5065:Olfr981 UTSW 9 40023250 missense probably benign 0.44
R5467:Olfr981 UTSW 9 40022437 missense probably benign 0.00
R5668:Olfr981 UTSW 9 40022668 missense probably damaging 1.00
R5687:Olfr981 UTSW 9 40022435 missense probably damaging 1.00
R6432:Olfr981 UTSW 9 40022528 missense probably damaging 1.00
R6620:Olfr981 UTSW 9 40022929 missense probably damaging 1.00
R6992:Olfr981 UTSW 9 40022600 nonsense probably null
R7156:Olfr981 UTSW 9 40023230 missense probably benign 0.23
R7250:Olfr981 UTSW 9 40022754 nonsense probably null
R7273:Olfr981 UTSW 9 40022665 missense probably benign 0.04
R8006:Olfr981 UTSW 9 40022474 missense probably damaging 1.00
R8701:Olfr981 UTSW 9 40022519 missense probably damaging 1.00
R8835:Olfr981 UTSW 9 40022875 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCCCATGTACTGGTTCCTATGTCAC -3'
(R):5'- AGGGCACATAGTAGACGATGACCAC -3'

Sequencing Primer
(F):5'- GTACTGGTTCCTATGTCACCTCTC -3'
(R):5'- GTCTACAAAGGTGACCAACTCATTG -3'
Posted On 2014-01-05