Mutagenetix > Incidental Mutations

Incidental Mutation 'R1117:Olfr981'

97420

Institutional Source

Beutler Lab

Gene Symbol

Olfr981

Ensembl Gene

ENSMUSG00000046678

Gene Name

olfactory receptor 981

Synonyms

MOR223-8, GA_x6K02T2PVTD-33720892-33721824

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40021464-40030377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40022762 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 123 (F123S)

Ref Sequence

ENSEMBL: ENSMUSP00000149436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059859] [ENSMUST00000215956]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059859
AA Change: F123S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057952
Gene: ENSMUSG00000046678
AA Change: F123S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	1.4e-54	PFAM
Pfam:7tm_1	41	288	8.8e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215956
AA Change: F123S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219526

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220338

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Peak1	G	A	9: 56,258,418	T742M	probably benign	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Olfr981

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01481:Olfr981	APN	9	40023278	missense	possibly damaging	0.61
IGL02089:Olfr981	APN	9	40022770	missense	probably damaging	1.00
R0722:Olfr981	UTSW	9	40022999	missense	probably damaging	1.00
R1781:Olfr981	UTSW	9	40023245	missense	probably damaging	1.00
R1874:Olfr981	UTSW	9	40022855	missense	possibly damaging	0.86
R1893:Olfr981	UTSW	9	40022974	missense	possibly damaging	0.64
R1942:Olfr981	UTSW	9	40022735	missense	probably damaging	1.00
R1942:Olfr981	UTSW	9	40022752	missense	probably damaging	1.00
R1999:Olfr981	UTSW	9	40022689	missense	probably benign
R2000:Olfr981	UTSW	9	40022689	missense	probably benign
R2173:Olfr981	UTSW	9	40023254	missense	probably damaging	0.97
R2760:Olfr981	UTSW	9	40022396	start codon destroyed	probably null	0.00
R4300:Olfr981	UTSW	9	40023139	missense	probably benign	0.02
R4530:Olfr981	UTSW	9	40023293	missense	probably benign
R4614:Olfr981	UTSW	9	40022959	missense	probably damaging	1.00
R4661:Olfr981	UTSW	9	40022527	missense	probably damaging	1.00
R4777:Olfr981	UTSW	9	40022698	missense	possibly damaging	0.90
R5017:Olfr981	UTSW	9	40022376	start gained	probably benign
R5065:Olfr981	UTSW	9	40023250	missense	probably benign	0.44
R5467:Olfr981	UTSW	9	40022437	missense	probably benign	0.00
R5668:Olfr981	UTSW	9	40022668	missense	probably damaging	1.00
R5687:Olfr981	UTSW	9	40022435	missense	probably damaging	1.00
R6432:Olfr981	UTSW	9	40022528	missense	probably damaging	1.00
R6620:Olfr981	UTSW	9	40022929	missense	probably damaging	1.00
R6992:Olfr981	UTSW	9	40022600	nonsense	probably null
R7156:Olfr981	UTSW	9	40023230	missense	probably benign	0.23
R7250:Olfr981	UTSW	9	40022754	nonsense	probably null
R7273:Olfr981	UTSW	9	40022665	missense	probably benign	0.04
R8006:Olfr981	UTSW	9	40022474	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCATGTACTGGTTCCTATGTCAC -3'
(R):5'- AGGGCACATAGTAGACGATGACCAC -3'

Sequencing Primer
(F):5'- GTACTGGTTCCTATGTCACCTCTC -3'
(R):5'- GTCTACAAAGGTGACCAACTCATTG -3'

Posted On

2014-01-05