Incidental Mutation 'R0988:H2afy'
ID97421
Institutional Source Beutler Lab
Gene Symbol H2afy
Ensembl Gene ENSMUSG00000015937
Gene NameH2A histone family, member Y
SynonymsH2AF12M, mH2a1, MACROH2A1.2, macroH2A1
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56073619-56136361 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 56083296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016081] [ENSMUST00000016081] [ENSMUST00000045788] [ENSMUST00000045788]
Predicted Effect probably null
Transcript: ENSMUST00000016081
SMART Domains Protein: ENSMUSP00000016081
Gene: ENSMUSG00000015937

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 330 2.72e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000016081
SMART Domains Protein: ENSMUSP00000016081
Gene: ENSMUSG00000015937

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 330 2.72e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045788
SMART Domains Protein: ENSMUSP00000038221
Gene: ENSMUSG00000015937

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 327 4.88e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045788
SMART Domains Protein: ENSMUSP00000038221
Gene: ENSMUSG00000015937

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 327 4.88e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225993
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile and display no gross phenotypic abnormalities. Mice homozygous for a different knock-out allele exhibit female-specific hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in H2afy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:H2afy APN 13 56074319 missense possibly damaging 0.75
IGL01294:H2afy APN 13 56074300 missense probably damaging 1.00
IGL02505:H2afy APN 13 56074330 missense probably damaging 1.00
IGL02994:H2afy APN 13 56104299 splice site probably benign
R0270:H2afy UTSW 13 56096114 splice site probably benign
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1638:H2afy UTSW 13 56104909 missense probably damaging 1.00
R1782:H2afy UTSW 13 56074321 missense probably damaging 0.99
R1850:H2afy UTSW 13 56096239 splice site probably benign
R1860:H2afy UTSW 13 56083204 missense probably damaging 1.00
R2228:H2afy UTSW 13 56084262 missense probably damaging 1.00
R4674:H2afy UTSW 13 56083184 missense possibly damaging 0.91
R5102:H2afy UTSW 13 56096123 critical splice donor site probably null
R5106:H2afy UTSW 13 56088293 missense possibly damaging 0.75
R5161:H2afy UTSW 13 56089781 missense probably benign 0.05
R5862:H2afy UTSW 13 56074271 missense probably damaging 1.00
R6165:H2afy UTSW 13 56104455 missense probably damaging 0.97
R6588:H2afy UTSW 13 56104489 missense possibly damaging 0.90
R6994:H2afy UTSW 13 56089830 missense probably benign 0.11
R7669:H2afy UTSW 13 56128333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAAGGCGATGGATTTCAGC -3'
(R):5'- TGTGACCAGTGTGTAGGGCATCAG -3'

Sequencing Primer
(F):5'- ATGGATTTCAGCTTTCTGTCATCAG -3'
(R):5'- ACTGACCAGCATTCAGTGG -3'
Posted On2014-01-05