Mutagenetix > Incidental Mutation

Incidental Mutation 'R1117:Peak1'

97422

Institutional Source

Beutler Lab

Gene Symbol

Peak1

Ensembl Gene

ENSMUSG00000074305

Gene Name

pseudopodium-enriched atypical kinase 1

Synonyms

C230081A13Rik, NKF3 kinase family member, 1110049L02Rik

MMRRC Submission

039190-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.229) question?

Stock #

R1117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56201126-56418067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 56258418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 742 (T742M)

Ref Sequence

ENSEMBL: ENSMUSP00000109901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]

AlphaFold

Q69Z38

Predicted Effect

probably benign
Transcript: ENSMUST00000061552
AA Change: T742M

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: T742M

Domain	Start	End	E-Value	Type
low complexity region	247	259	N/A	INTRINSIC
low complexity region	325	336	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	498	509	N/A	INTRINSIC
low complexity region	845	856	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	932	948	N/A	INTRINSIC
Pfam:Pkinase_Tyr	1437	1649	1.5e-6	PFAM
Pfam:Pkinase	1440	1651	2.3e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181444

Predicted Effect

probably benign
Transcript: ENSMUST00000186735

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l2	G	A	10: 83,508,623	T353I	probably benign	Het
Arpc1b	T	C	5: 145,125,754	V226A	possibly damaging	Het
Casz1	C	A	4: 148,934,595	T451K	probably damaging	Het
Ccr4	C	T	9: 114,492,017	V327M	probably benign	Het
Cntrl	A	G	2: 35,127,973	E465G	probably damaging	Het
Cpa1	A	G	6: 30,645,261	D412G	probably benign	Het
Crispld1	T	A	1: 17,749,622	N281K	probably benign	Het
Cul3	T	C	1: 80,280,924	Q465R	probably damaging	Het
Cyp2c68	G	A	19: 39,712,459	T305M	probably damaging	Het
Elp4	T	C	2: 105,842,311	D143G	probably benign	Het
Etnppl	A	G	3: 130,634,563	I462M	probably benign	Het
Fmo4	A	G	1: 162,803,663	V245A	probably benign	Het
Gm4076	A	G	13: 85,127,318		noncoding transcript	Het
Gm9573	T	C	17: 35,620,028		probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Kcnj15	G	A	16: 95,295,625	M8I	probably benign	Het
Klk1b22	A	T	7: 44,116,859	M255L	probably benign	Het
Mmrn1	T	A	6: 60,976,325	I530K	possibly damaging	Het
Nid2	A	C	14: 19,763,664		probably null	Het
Olfr311	A	G	11: 58,841,815	K234E	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Olfr981	T	C	9: 40,022,762	F123S	probably damaging	Het
Sel1l3	T	A	5: 53,172,607	T469S	probably benign	Het
Sez6	A	G	11: 77,974,514	Y659C	probably damaging	Het
Slc19a2	A	T	1: 164,263,456	I278F	possibly damaging	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Tcerg1	A	G	18: 42,574,652	D1079G	probably damaging	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Umod	T	C	7: 119,477,306	N79S	possibly damaging	Het
Wdr43	A	G	17: 71,616,387	T43A	probably benign	Het

Other mutations in Peak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Peak1	APN	9	56227326	missense	probably damaging	1.00
IGL00544:Peak1	APN	9	56259978	missense	probably damaging	1.00
IGL01141:Peak1	APN	9	56258527	missense	probably benign	0.01
IGL01743:Peak1	APN	9	56259202	missense	probably damaging	1.00
IGL01781:Peak1	APN	9	56260065	missense	possibly damaging	0.92
IGL01885:Peak1	APN	9	56260104	missense	probably damaging	1.00
IGL01941:Peak1	APN	9	56258775	missense	probably damaging	1.00
IGL02455:Peak1	APN	9	56227473	missense	possibly damaging	0.89
IGL02719:Peak1	APN	9	56227206	missense	probably damaging	1.00
IGL03247:Peak1	APN	9	56257930	missense	probably damaging	1.00
IGL03259:Peak1	APN	9	56259967	missense	probably damaging	1.00
R0060:Peak1	UTSW	9	56227823	missense	probably damaging	1.00
R0087:Peak1	UTSW	9	56258325	missense	probably damaging	1.00
R0480:Peak1	UTSW	9	56258632	missense	probably benign	0.00
R0569:Peak1	UTSW	9	56260089	missense	probably damaging	1.00
R0605:Peak1	UTSW	9	56227098	splice site	probably benign
R0865:Peak1	UTSW	9	56257832	missense	probably benign	0.02
R1922:Peak1	UTSW	9	56206687	missense	probably damaging	1.00
R1959:Peak1	UTSW	9	56206789	missense	probably damaging	1.00
R2069:Peak1	UTSW	9	56258759	missense	probably damaging	1.00
R2083:Peak1	UTSW	9	56258949	missense	probably damaging	1.00
R2154:Peak1	UTSW	9	56207212	missense	probably damaging	1.00
R2407:Peak1	UTSW	9	56259226	missense	probably damaging	1.00
R3832:Peak1	UTSW	9	56258383	missense	probably benign
R3938:Peak1	UTSW	9	56260365	missense	probably benign	0.01
R3964:Peak1	UTSW	9	56259979	missense	probably damaging	1.00
R4192:Peak1	UTSW	9	56258741	missense	probably damaging	1.00
R4381:Peak1	UTSW	9	56258427	missense	probably benign	0.34
R4869:Peak1	UTSW	9	56227592	missense	probably benign	0.06
R4994:Peak1	UTSW	9	56241276	missense	possibly damaging	0.65
R5062:Peak1	UTSW	9	56260289	missense	probably damaging	1.00
R5435:Peak1	UTSW	9	56206486	missense	probably damaging	0.98
R5632:Peak1	UTSW	9	56257774	missense	probably damaging	1.00
R5643:Peak1	UTSW	9	56258755	missense	probably damaging	0.99
R5880:Peak1	UTSW	9	56207610	missense	probably damaging	1.00
R5898:Peak1	UTSW	9	56207338	missense	probably benign	0.19
R5986:Peak1	UTSW	9	56259442	missense	probably benign	0.00
R6109:Peak1	UTSW	9	56259283	missense	probably benign	0.01
R6284:Peak1	UTSW	9	56260296	missense	probably benign	0.10
R6347:Peak1	UTSW	9	56258211	missense	probably benign	0.00
R6374:Peak1	UTSW	9	56257666	missense	probably damaging	1.00
R6471:Peak1	UTSW	9	56258259	missense	probably damaging	1.00
R6717:Peak1	UTSW	9	56207239	missense	probably benign	0.00
R7033:Peak1	UTSW	9	56259707	missense	probably damaging	1.00
R7039:Peak1	UTSW	9	56257809	missense	probably benign	0.01
R7100:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R7604:Peak1	UTSW	9	56241207	nonsense	probably null
R7868:Peak1	UTSW	9	56260470	missense	probably damaging	1.00
R7979:Peak1	UTSW	9	56207392	missense	possibly damaging	0.52
R8258:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8259:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8272:Peak1	UTSW	9	56258898	missense	probably damaging	1.00
R8324:Peak1	UTSW	9	56207476	missense	probably damaging	1.00
R8516:Peak1	UTSW	9	56260000	missense	probably damaging	1.00
R8847:Peak1	UTSW	9	56207143	missense	probably damaging	1.00
R8895:Peak1	UTSW	9	56206654	missense	probably benign
R9082:Peak1	UTSW	9	56258220	missense	probably benign	0.07
R9138:Peak1	UTSW	9	56257641	missense	probably benign	0.34
R9355:Peak1	UTSW	9	56260170	missense	probably damaging	1.00
R9548:Peak1	UTSW	9	56206633	missense	probably benign	0.19
R9591:Peak1	UTSW	9	56259550	missense	possibly damaging	0.48
R9642:Peak1	UTSW	9	56259921	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCACCTTCCCCACTAGACTGAGATG -3'
(R):5'- TCCCCAAGCTAAAGGGTTTTCCAAC -3'

Sequencing Primer
(F):5'- AGTATCTGCATCTGGGGGAAC -3'
(R):5'- GGGTTTTCCAACAGCACAG -3'

Posted On

2014-01-05