Incidental Mutation 'R0988:Thrb'
ID97423
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Namethyroid hormone receptor beta
Synonymsc-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location17660261-18038090 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 17981837 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471] [ENSMUST00000224934]
Predicted Effect probably benign
Transcript: ENSMUST00000022303
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022304
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091471
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224512
Predicted Effect probably benign
Transcript: ENSMUST00000224934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225876
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18011056 splice site probably benign
IGL02488:Thrb APN 14 18033455 missense probably damaging 0.98
IGL02598:Thrb APN 14 18008606 missense possibly damaging 0.95
IGL02707:Thrb APN 14 18026721 missense probably benign 0.42
harry UTSW 14 18011145 nonsense probably null
R0479:Thrb UTSW 14 18033643 missense probably damaging 0.99
R1257:Thrb UTSW 14 18008642 missense probably damaging 1.00
R1522:Thrb UTSW 14 18002597 missense probably damaging 1.00
R1927:Thrb UTSW 14 18008674 missense probably damaging 1.00
R2100:Thrb UTSW 14 18030393 missense possibly damaging 0.73
R2134:Thrb UTSW 14 18033487 missense probably benign 0.22
R3551:Thrb UTSW 14 17963214 missense probably damaging 0.99
R3888:Thrb UTSW 14 18033551 missense probably damaging 1.00
R3975:Thrb UTSW 14 18033456 missense probably damaging 1.00
R4294:Thrb UTSW 14 18011145 nonsense probably null
R4371:Thrb UTSW 14 18030275 missense probably damaging 1.00
R4454:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4457:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4486:Thrb UTSW 14 17925640 start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18011076 missense probably benign 0.39
R5184:Thrb UTSW 14 18011181 nonsense probably null
R5609:Thrb UTSW 14 18033526 missense probably benign 0.22
R6023:Thrb UTSW 14 18011209 missense probably damaging 0.98
R6891:Thrb UTSW 14 17981899 missense probably benign
R7288:Thrb UTSW 14 18030186 missense probably damaging 1.00
R7294:Thrb UTSW 14 17826963 start gained probably benign
R7780:Thrb UTSW 14 18008608 missense possibly damaging 0.73
R8098:Thrb UTSW 14 18008645 missense probably damaging 1.00
Z1177:Thrb UTSW 14 18033433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCATTTTCCCCAGCAATAAGC -3'
(R):5'- TTGGACATCACGACCACTGAGAGC -3'

Sequencing Primer
(F):5'- TGTTCTTCACGGCAGCAG -3'
(R):5'- GCCGGACTGTCTTCCAGATATG -3'
Posted On2014-01-05