Incidental Mutation 'R1117:Trim43c'
ID 97426
Institutional Source Beutler Lab
Gene Symbol Trim43c
Ensembl Gene ENSMUSG00000067399
Gene Name tripartite motif-containing 43C
Synonyms Trim43
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 88839164-88848190 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88844977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 286 (S286P)
Ref Sequence ENSEMBL: ENSMUSP00000129255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163255] [ENSMUST00000186363]
AlphaFold P86449
Predicted Effect probably benign
Transcript: ENSMUST00000163255
AA Change: S286P

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129255
Gene: ENSMUSG00000067399
AA Change: S286P

RING 16 56 3.34e-6 SMART
PDB:2IWG|E 329 446 3e-15 PDB
Blast:SPRY 336 441 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180783
Predicted Effect probably benign
Transcript: ENSMUST00000186363
AA Change: S285P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139715
Gene: ENSMUSG00000067399
AA Change: S285P

RING 16 56 1.6e-8 SMART
SPRY 334 445 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188156
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Trim43c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trim43c APN 9 88841856 missense probably benign 0.20
IGL02414:Trim43c APN 9 88841832 critical splice acceptor site probably null
R0054:Trim43c UTSW 9 88847515 missense probably damaging 1.00
R0765:Trim43c UTSW 9 88841916 missense probably benign 0.28
R0862:Trim43c UTSW 9 88843034 missense probably benign 0.01
R0864:Trim43c UTSW 9 88843034 missense probably benign 0.01
R1222:Trim43c UTSW 9 88843078 missense possibly damaging 0.70
R1643:Trim43c UTSW 9 88847477 missense probably damaging 0.97
R1691:Trim43c UTSW 9 88840699 missense probably damaging 0.98
R1914:Trim43c UTSW 9 88840617 missense probably benign 0.01
R3718:Trim43c UTSW 9 88844977 missense probably benign 0.20
R3772:Trim43c UTSW 9 88847757 missense probably damaging 1.00
R3852:Trim43c UTSW 9 88840401 missense probably damaging 1.00
R4774:Trim43c UTSW 9 88847652 missense possibly damaging 0.48
R5784:Trim43c UTSW 9 88847643 missense probably benign 0.03
R5833:Trim43c UTSW 9 88843037 missense possibly damaging 0.74
R6177:Trim43c UTSW 9 88840547 missense possibly damaging 0.50
R6407:Trim43c UTSW 9 88840414 missense probably benign
R6490:Trim43c UTSW 9 88844950 missense possibly damaging 0.50
R6892:Trim43c UTSW 9 88844924 missense probably benign 0.35
R8050:Trim43c UTSW 9 88840337 missense probably damaging 0.99
R8417:Trim43c UTSW 9 88843138 missense probably benign 0.20
R9276:Trim43c UTSW 9 88841913 missense probably benign
Z1088:Trim43c UTSW 9 88842935 critical splice acceptor site probably null
Predicted Primers PCR Primer
(R):5'- TCACTGTGGggagctggagaaatg -3'

Sequencing Primer
(F):5'- cagtcagtcttctccttacacc -3'
(R):5'- gcaccgactgctcttcc -3'
Posted On 2014-01-05