Incidental Mutation 'R0988:Nadk2'
ID97427
Institutional Source Beutler Lab
Gene Symbol Nadk2
Ensembl Gene ENSMUSG00000022253
Gene NameNAD kinase 2, mitochondrial
Synonyms4933430B08Rik, 1110020G09Rik, MNADK, Nadkd1
MMRRC Submission 039108-MU
Accession Numbers

Genbank: NM_001040395; MGI: 1915896

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0988 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9071260-9110891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9102992 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 310 (N310K)
Ref Sequence ENSEMBL: ENSMUSP00000098354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000100789] [ENSMUST00000100790] [ENSMUST00000188194]
Predicted Effect probably damaging
Transcript: ENSMUST00000067760
AA Change: N332K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253
AA Change: N332K

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100789
AA Change: N281K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253
AA Change: N281K

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100790
AA Change: N310K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253
AA Change: N310K

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186069
Predicted Effect probably benign
Transcript: ENSMUST00000188194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228453
Meta Mutation Damage Score 0.7285 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial kinase that catalyzes the phosphorylation of NAD to yield NADP. Mutations in this gene result in 2,4-dienoyl-CoA reductase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for knock-out allele exhibit increased serum lysine and carnitine levels, develop increased reactive oxygen species levels and hepatic steatosis on an atherogenic high-fat diet, and show impaired fasting-induced fatty acid oxidation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Nadk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Nadk2 APN 15 9102984 missense probably damaging 1.00
tabak UTSW 15 9108254 missense probably damaging 0.99
PIT4131001:Nadk2 UTSW 15 9100143 frame shift probably null
PIT4142001:Nadk2 UTSW 15 9100143 frame shift probably null
R0347:Nadk2 UTSW 15 9084207 missense probably benign 0.08
R0838:Nadk2 UTSW 15 9091242 missense probably benign 0.00
R1014:Nadk2 UTSW 15 9091254 missense probably damaging 1.00
R1159:Nadk2 UTSW 15 9106837 missense possibly damaging 0.86
R1387:Nadk2 UTSW 15 9106782 missense possibly damaging 0.68
R1861:Nadk2 UTSW 15 9108311 missense probably benign 0.21
R1886:Nadk2 UTSW 15 9103358 missense possibly damaging 0.87
R2354:Nadk2 UTSW 15 9085782 missense probably damaging 1.00
R3623:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R3624:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R4642:Nadk2 UTSW 15 9092721 missense possibly damaging 0.64
R4867:Nadk2 UTSW 15 9098857 missense possibly damaging 0.84
R5314:Nadk2 UTSW 15 9108313 missense probably benign 0.04
R7214:Nadk2 UTSW 15 9108254 missense probably damaging 0.99
R7244:Nadk2 UTSW 15 9083191 splice site probably null
R7310:Nadk2 UTSW 15 9103381 critical splice donor site probably null
R7634:Nadk2 UTSW 15 9092846 missense probably benign 0.41
R8310:Nadk2 UTSW 15 9103332 missense probably benign
R8424:Nadk2 UTSW 15 9083334 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGGAGATACACTTCAGTTCTTTCCCG -3'
(R):5'- AGAGTCAGATTTCCTTGTCGTCTTGC -3'

Sequencing Primer
(F):5'- AACAGGTTACTTTCAAGCCTTTGC -3'
(R):5'- acaaatacacaacacaactcaaatac -3'
Posted On2014-01-05