Mutagenetix > Incidental Mutations

Incidental Mutation 'R0988:Serac1'

97433

Institutional Source

Beutler Lab

Gene Symbol

Serac1

Ensembl Gene

ENSMUSG00000015659

Gene Name

serine active site containing 1

Synonyms

4930511N22Rik, D17Ertd141e

MMRRC Submission

039108-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6042196-6079741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 6061580 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 244 (F244I)

Ref Sequence

ENSEMBL: ENSMUSP00000024570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]

Predicted Effect

probably benign
Transcript: ENSMUST00000024570
AA Change: F244I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: F244I

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
low complexity region	161	169	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
SCOP:d1jdha_	243	336	3e-5	SMART
Pfam:PGAP1	360	519	3.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097432
AA Change: F274I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: F274I

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
SCOP:d1gw5a_	89	464	3e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139542

Meta Mutation Damage Score

0.1127

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	C	12: 118,932,575	I340V	probably benign	Het
Ano1	T	G	7: 144,633,653	S459R	possibly damaging	Het
Cop1	T	C	1: 159,232,847	V67A	possibly damaging	Het
Cop1	A	G	1: 159,244,672	Y186C	probably damaging	Het
Cst11	G	A	2: 148,770,426	T97I	probably benign	Het
Ephb2	T	A	4: 136,659,708	Y736F	possibly damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
H2afy	T	C	13: 56,083,296		probably null	Het
Hmcn2	T	C	2: 31,335,451	I124T	probably damaging	Het
Hpn	T	C	7: 31,099,898	Y271C	possibly damaging	Het
Kmt2a	A	G	9: 44,848,549	S668P	probably benign	Het
Krtap4-9	T	A	11: 99,785,536	C94*	probably null	Het
Lgmn	T	C	12: 102,398,277	D311G	probably damaging	Het
Mfsd14b	T	C	13: 65,112,493		probably benign	Het
Micu1	C	A	10: 59,756,727		probably benign	Het
Muc5b	A	G	7: 141,871,795	I4726V	probably benign	Het
Nadk2	T	A	15: 9,102,992	N310K	probably damaging	Het
Napg	T	C	18: 62,983,360		probably benign	Het
Nav3	G	A	10: 109,716,528	R1818W	probably damaging	Het
Ntpcr	T	C	8: 125,737,431		probably benign	Het
Olfr1451	A	G	19: 12,999,787	D267G	probably benign	Het
Olfr341	T	C	2: 36,479,767	D121G	probably damaging	Het
Olfr609	T	A	7: 103,492,747	I44F	probably damaging	Het
Olfr807	A	G	10: 129,754,997	V151A	probably benign	Het
Pdia2	A	G	17: 26,198,829	F69L	probably damaging	Het
Pik3r4	A	G	9: 105,687,205	T1333A	probably damaging	Het
Platr26	A	T	2: 71,723,287		noncoding transcript	Het
Proc	T	C	18: 32,133,483	D97G	probably benign	Het
Ptpn23	C	T	9: 110,388,777	R700H	probably benign	Het
Rragc	T	A	4: 123,924,782		probably null	Het
Snrpd3	A	G	10: 75,532,205	D52G	probably damaging	Het
Thrb	G	T	14: 17,981,837		probably benign	Het
Ttc6	T	C	12: 57,688,649		probably benign	Het
Zfp607b	T	A	7: 27,702,976	C286S	probably benign	Het

Other mutations in Serac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Serac1	APN	17	6074253	splice site	probably benign
IGL02642:Serac1	APN	17	6045746	missense	possibly damaging	0.56
IGL02972:Serac1	APN	17	6070764	nonsense	probably null
FR4304:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4340:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4342:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4589:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
PIT4480001:Serac1	UTSW	17	6050812	missense	probably damaging	1.00
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0127:Serac1	UTSW	17	6048840	missense	probably damaging	1.00
R0211:Serac1	UTSW	17	6050060	missense	possibly damaging	0.67
R0245:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0538:Serac1	UTSW	17	6048826	splice site	probably benign
R0652:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R1965:Serac1	UTSW	17	6048999	missense	possibly damaging	0.72
R1984:Serac1	UTSW	17	6045689	splice site	probably null
R2145:Serac1	UTSW	17	6050785	missense	probably damaging	1.00
R3426:Serac1	UTSW	17	6066778	missense	probably benign	0.04
R3921:Serac1	UTSW	17	6066792	missense	probably damaging	1.00
R4760:Serac1	UTSW	17	6051790	missense	possibly damaging	0.69
R4958:Serac1	UTSW	17	6069382	missense	probably benign	0.15
R5552:Serac1	UTSW	17	6056692	nonsense	probably null
R5874:Serac1	UTSW	17	6043913	unclassified	probably benign
R5964:Serac1	UTSW	17	6065049	missense	probably benign
R6614:Serac1	UTSW	17	6045662	missense	probably damaging	1.00
R6794:Serac1	UTSW	17	6051710	missense	probably damaging	1.00
R6949:Serac1	UTSW	17	6051815	missense	probably damaging	1.00
R7157:Serac1	UTSW	17	6074201	missense	probably benign
R7161:Serac1	UTSW	17	6065076	missense	probably damaging	0.97
R7426:Serac1	UTSW	17	6069314	missense	probably damaging	1.00
R8270:Serac1	UTSW	17	6050758	missense	probably damaging	1.00
Z1088:Serac1	UTSW	17	6048918	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCACATTTAGAGCATGAACTCCTTGTA -3'
(R):5'- TGGCAGACTTGTTTTGGGAATCACT -3'

Sequencing Primer
(F):5'- agtgtcctcttctgtcctcc -3'
(R):5'- ACACAGTATAAGTTTCATAACATCCC -3'

Posted On

2014-01-05